WWW.MASH.DOBROTA.BIZ
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - онлайн публикации
 

Pages:   || 2 |

«Фокин Артём Игоревич ИЗУЧЕНИЕ МОЛЕКУЛЯРНЫХ МЕХАНИЗМОВ ОРГАНИЗАЦИИ ЦИТОСКЕЛЕТА И РЕГУЛЯЦИИ КЛЕТОЧНОЙ ПОДВИЖНОСТИ ПРОТЕИНКИНАЗОЙ LOSK/SLK ...»

-- [ Страница 1 ] --

Федеральное государственное бюджетное образовательное учреждение

высшего профессионального образования

«Московский государственный университет имени М.В.Ломоносова»

На правах рукописи

Фокин Артём Игоревич

ИЗУЧЕНИЕ МОЛЕКУЛЯРНЫХ МЕХАНИЗМОВ

ОРГАНИЗАЦИИ ЦИТОСКЕЛЕТА И РЕГУЛЯЦИИ КЛЕТОЧНОЙ

ПОДВИЖНОСТИ ПРОТЕИНКИНАЗОЙ LOSK/SLK

03.03.04

Клеточная биология, цитология, гистология диссертация на соискание ученой степени кандидата биологических наук

Научный руководитель – д. б. н., проф .

Надеждина Елена Сергеевна Москва – 2015

1. Оглавление Оглавление

1 .

Введение

2 .

Актуальность темы исследования

2.1 .

Цель работы

2.2 .

Задачи исследования

2.3 .

Новизна полученных результатов

2.4 .

Апробация результатов исследования

2.5 .

Обзор литературы

3 .

Серин-треониновая протеинкиназа LOSK/SLK

3.1 .

Цитоскелет и его функции в животных клетках

3.2 .

Микротрубочки

3.2.1 .

Белки, ассоциированные с микротрубочками (МАР)

3.2.1.1 .

Моторные белки микротрубочек

3.2.1.2 .

Динеин-динактиновый комплекс

3.2.1.3 .



Центр организации микротрубочек

Фосфорилирование р150Glued киназой LOSK не влияет на активность 5.3.2 .

динеинового транспорта в клетке

Ингибирование LOSK нарушает внутриклеточный транспорт на 5.3.3 .

длинные дистанции

Фосфорилирование белка p150Glued протеинкиназой LOSK 5.3.4 .

определяет его центросомную локализацию

5.4. Регуляция центросомной локализации PCM-1 посредством LOSK

Ингибирование LOSK вызывает перераспределение центросомного 5.4.1 .

белка PCM-1 в цитоплазму

Нарушение естественной локализации p150Glued в клетках ведёт к 5.4.2 .

истощению центросомного пула PCM-1

Нарушение радиальной системы микротрубочек приводит к 5.4.3 .

снижению содержания PCM-1 на центросоме до уровня, наблюдаемого при ингибировании LOSK

Ингибирование LOSK, сопровождаемое потерей центросомной 5.4.4 .

локализации белком PCM-1, не приводит к значительным нарушениям формирования первичных ресничек в клетках

Участие LOSK в организации микротрубочек на аппарате Гольджи... 84 5.5 .

Выбор клеточной модели для изучения организации микротрубочек 5.5.1 .

посредством аппарата Гольджи

В клетках, использующих аппарат Гольджи в качестве ЦОМТа, 5.5.2 .

активность LOSK незначительно влияет на организацию микротрубочек

Регуляция клеточной подвижности протеинкиназой LOSK.................. 88 5.6 .

Выбор экспериментальной модели для изучения миграции клеток .

5.6.1 .

Ингибирование LOSK приводит к нарушениям клеточной миграции

5.6.2. Точечная мутация RhoA в сайте фосфорилирования киназой LOSK приводит к изменению подвижности клеток

Генетические конструкции, кодирующие GFP-слитые RhoA, 5.6.3 .

обладающие различной активностью, по-разному влияют на клеточную подвижность........... 91 Имитирующая фосфорилирование RhoA восстанавливает скорость, 5.6.4 .

но не направленность движения клеток на фоне ингибирования LOSK



Имитирующий фосфорилирование p150Glued способен частично 5.6.5 .

восстанавливать направленность движения клеток

Ингибирование LOSK или экспрессия RhoA-S188A изменяют 5.6.6 .

морфологию актинового цитоскелета

Ингибитор RhoA-зависимой киназы p160ROCK восстанавливает 5.6.7 .

параметры клеточной подвижности на фоне ингибирования LOSK

Поляризация аппарата Гольджи в клетках зависит от активности 5.6.8 .

RhoA. RhoA-S188Е восстанавливает поляризацию АГ при ингибировании LOSK.................. 101 Способность клеток к направленной миграции не зависит от 5.6.9 .

состояния системы микротрубочек, регулируемого LOSK

Обсуждение результатов

6 .

Заключение

7 .

Выводы

8 .

Список сокращений

9 .

Названия белков

9.1 .

Список цитируемой литературы

10 .

Приложение. Дополнительный иллюстративный материал.. 139 11 .

–  –  –

Многие внутриклеточные процессы регулируются путём обратимого фосфорилирования белков: в клетке одновременно работает огромное количество киназ и фосфатаз. Одним из таких белков является LOSK, впервые описаный как связаная с микротрубочками и центросомой протеинкиназа. К настоящему времени расшифрованы многие аспекты функционирования этого белка. Например, показана значимость LOSK в регуляции клеточного цикла, клеточной гибели и дифференцировки. Под контролем этой киназы находятся такие существенные аспекты функционирования клетки как организация актинового и микротрубочкового цитоскелета, а также клеточная подвижность. Однако на сегодняшний день остаётся невыясненным, какие нисходящие сигнальные пути от LOSK участвуют в регуляции образования упорядоченной системы микротрубочек и направленной миграции клеток. Среди относительно небольшого числа её субстратов, известных на сегодняшний день, особо выделяются компонент динактинового комплекса - белок p150Glued (его минорная 1Аизоформа) и малая ГТФаза RhoA. Оба этих белка способны влиять на поляризацию клеток и их подвижность, а также на организацию микротрубочек, и, вероятно, регуляция этих важных процессов, находящихся под контролем может осуществляться посредством LOSK, координированных действий этих белков .

Как сама киназа LOSK, так и её субстраты p150Glued и RhoA играют незаменимую роль в процессе жизнедеятельности клеток и организма в целом. Таким образом, изучение сигнальных путей с участием киназы LOSK и её эффекторов является перспективным как с точки зрения фундаментальной науки, так и прикладной. Расшифровка этих сигнальных путей поможет расширить наши представления о функционировании клеток и помочь в изучении основ патогенеза некоторых заболеваний .

–  –  –

Изучить молекулярные механизмы регуляции протеинкиназой LOSK организации микротрубочек, актинового цитоскелета, а также процессов направленного движения клеток .

–  –  –





1) Изучить особенности фосфорилирования 1А-изоформы белка p150Glued протеинкиназой

LOSK:

1а) Определить, какой или какие именно из треонинов Т145-Т147 может (могут) быть фосфорилирован(ы) посредством LOSK .

1б) Изучить влияние мутаций в динактине-1 R148W и R149Q, обнаруженных у больных боковым амиотрофическим склерозом, на его фосфорилирование посредством LOSK .

2а) Изучить влияние киназы LOSK на сборку и клеточную локализацию динеиндинактинового комплекса .

2б) Изучить влияние киназы LOSK на внутриклеточный транспорт в кратковременных и долговременных событиях .

3) Изучить влияние активности LOSK на локализацию центросомного белка PCM-1 и образование первичных ресничек в клетках .

4) Изучить участие LOSK в организации микротрубочек на аппарате Гольджи .

5) Определить, какие из сигнальных путей, регулируемых киназой LOSK, участвуют в направленном движении клеток:

5а) Изучить влияние ингибирования LOSK, а также синтеза в клетках нефосфорилируемой и имитирующей фосфорилирование малой ГТФазы RhoA на параметры клеточной подвижности .

5б) Изучить влияние ингибирования LOSK, а также синтеза в клетках нефосфорилируемой и имитирующей фосфорилирование малой ГТФазы RhoA на морфологию системы актинового цитоскелета .

5в) Оценить восстановление поляризации клеток и параметров их подвижности, нарушенных ингибированием LOSK, при экспрессии имитирующих фосфорилирование динактина-1 (p150Glued) и RhoA .

5г) Определить, опосредована ли регуляция киназой LOSK клеточной подвижности её влиянием на активность основного эффектора RhoA - киназы р160ROCK .

5д) Оценить вклад радиальной системы микротрубочек, регулируемой LOSK, на подвижность клеток .

2.4. Новизна полученных результатов

В данной работе получены оригинальные данные, раскрывающие особенности регуляции процессов направленной клеточной миграции и организации микротрубочек протеинкиназой LOSK. Впервые изучена роль фосфорилирования связанных с цитоскелетом белков: динактинаp150Glued и малой ГТФазы RhoA в вышеописанных процессах. Показано, что участие LOSK в p150Glued, организации микротрубочек опосредовано фосфорилированием белка не оказывающим влияние на функционирование динеин-динактинового комплекса, но, приводящим к центросомной локализации динактина. Впервые обнаружено, что активность p150Glued киназы определяет центросомную локализацию партнёра белка LOSK перицентриолярного материала PCM-1, причем независимо от локализации динактина-1. Эти пути передачи сигнала (LOSK - p150Glued и LOSK - ? - PCM1) регулируют центросомную организацию микротрубочек в клетках, но не участвуют в организации микротрубочек посредством аппарата Гольджи. Получены данные о том, что фосфорилирование малой ГТФазы RhoA киназой LOSK, не оказывающее эффекта на организацию микротрубочек, влияет на подвижность клеток, обеспечивая их направленную миграцию. В основе регуляции этого процесса может лежать изменение активности малой ГТФазы RhoA, сопровождаемой перестройками актинового цитоскелета, при её фосфорилировании киназой LOSK. В то же время, впервые обнаружено, что p150Glued, фосфорилированный LOSK, определяет поляризацию клеток и, вероятно, участвует в её поддержании во время направленной миграции. Также показано, что радиальная система микротрубочек, образуемая при участии LOSK, не вносит существенного вклада в скорость и направленность клеточного движения. Таким образом, в работе впервые исследованы молекулярные механизмы, лежащие в основе регуляции киназой LOSK организации микротрубочек и направленной миграции клеток .

–  –  –

Результаты данного диссертационного исследования были представлены на 5-ти национальных и 8-ми международных конференциях. Были опубликованы 1 статья в российском журнале, 1 статья в сборнике и 1 статья в международном журнале .

–  –  –

Протеинкиназа LOSK (Lоng Ste20-like Kinase) или SLK (Ste20-Like Kinase) принадлежит к семейству киназ зародышевого центра (GCK), получившему название по первому его представителю: the Germinal Center Kinase, обнаруженному в В-клетках герминативных центров лимфоидных фолликулов (Katz et al., 1997) .

Семейство Ste-20 представляет собой обширную группу, в неё входят протеинкиназы, которые задействованы в регуляции клеточной пролиферации, дифференцировки и локомоции .

Собственно, белок, получивший название Ste-20 (Sterile 20), был идентифицирован в клетках дрожжей как киназа, передающая сигнал на MAP-киназный каскад (Zhao et al., 1995) и активируемая -субъединицей G-белков (Leberer et al., 1997). В дальнейшем, у человека, животных и растений было идентифицировано множество киназ, схожих со Ste-20. Среди них выделяют подсемейство PAK, p21-активируемых киназ (p21-activated kinases), имеющих каталитический домен на С-конце молекулы, и подсемейство обладающих GSK, каталитическим доменом, расположенным на N-конце (Dan et al., 2001; Depire, 2009). В низших эукариотах, кроме этого были обнаружены киназы PH-PAK (Plecstrin-Homology domain p21Activated Kinases), отличающиеся от PAK-киназ наличием домена, гомологичного плекстрину (Sells and Chernoff, 1997), что, по-видимому, может способствовать их связи с клеточными мембранами за счёт взаимодействия с фосфатидилинозитолтри- и би-фосфатом (Wang and Shaw, 1995) .

Киназа LOSK/SLK была обнаружена 2-мя независимыми группами исследователей в 1997 году. Киназа, сходная с дрожжевой Ste-20, была выделена из библиотеки кДНК клеток печени морской свинки как нерецепторная серин/треониновая киназа, ответственная за дифференцировку эозинофилов. Она получила название SLK, которое закрепилось за ней в дальнейшем (Itoh et al., 1997). В другой лаборатории путём скрининга экспрессионной библиотеки клеток CHO-K1 (культура клеток яичника китайского хомячка – Chinese hamster ovarium) была идентифицирована киназа, ассоциированная с центросомой и микротрубочками, и, отчасти локализующаяся в сплайсосомах ядер клеток (рисунок 1а) (Zinovkina et al., 1997). В дальнейшем оказалось, что в обоих случаях был обнаружен и охарактеризован один и тот же белок .

Рисунок 1. Протеинкиназа LOSK .

(1а) Иммунофлуоресцентное окрашивание клеток Vero антителами к LOSK. Видна центросомная локализация протеинкиназы (1б) .

Структура каталитического домена разрешенная при помощи LOSK, рентгеноструктурного анализа (Pike et al., 2008, с изменениями). (1в) Доменная структура LOSK и генетические конструкции LOSK, используемые в работе. Указаны каталитический домен (CD), кислый домен (AD) и домен с предсказанной структурой скрученной спирали – coiled-coil (СС) (Burakov et al., 2008а) .

Как уже было отмечено выше, киназа LOSK принадлежит подсемейству киназ герминативного центра. Данный белок состоит из 1204 или 1235 аминокислотных остатков и содержит N-концевой каталитический домен (34-292 а.о.) и C-концевой регуляторный домен, где находится сигнал ядерной локализации (рисунок 1б, 1в) (Itoh et al., 1997; Yamada et al., 2000). В условиях денатурирующего белкового электрофореза полипептид, соответствующий LOSK, мигрирует на уровне 200 кДа белков при предсказанной его массе в 148 кДа, что может быть результатом посттрансляционных модификаций или особенностей вторичной структуры его молекулы (Zinovkina et al., 1997, Sabourin and Rudnicki, 1999, Yamada et al., 2000). При изучении структуры LOSK было выдвинуто предположение о способности киназы к димеризации ввиду наличия в её С-концевом участке мотивов, способных образовывать структуру скрученной спирали (coiled coil) (Yamada et al., 2000). Действительно, оказалось, что иммунопреципитированная из клеток HA-SLK (полноразмерная SLK, слитая с фрагментом геммаглютинина вируса гриппа) была способна связываться с GST-слитым C-концевым доменом SLK, что приводило к повышению её каталитической активности (Hao et al., 2006) .

По-видимому, то же происходит и при димеризации 2-х полноразмерных молекул киназы, что способствует эффективной активации киназы в клетках. Предположительно, именно в форме димера LOSK работает в клетке, хотя некоторые данные указывают на возможность присутствия в клетках и олигомерных комплексов (Delarosa et al., 2011) .

Активность LOSK может регулироваться автофосфорилированием. В N-концевой части молекулы, внутри её каталитического домена, была выявлена неконсенсусная последовательность, названная активирующим сегментом, которая может быть узнана каталитическим доменом другой молекулы белка (Oliver et al., 2007). Активирующий сегмент LOSK содержит, по крайней мере, два потенциальных сайта фосфорилирования: треонин-183 и серин-189. Каталитический домен LOSK способен димеризоваться in vitro и фосфорилировать активирующий сегмент другой молекулы по этим остаткам (Pike et al., 2008) (рисунок 1б) .

Недавно было показано, что мутации в активирующем сегменте сильно снижают киназную активность LOSK, что говорит о важной физиологической роли данного механизма (Luhovy et al., 2012) .

Активность LOSK в клетках может регулироваться посттранскрипционным механизмом, который работает, по крайней мере, в клетках ренального эпителия. Было показано, что в матричной РНК киназы, в её 3 -нетранслируемой области, находятся 5 AUUUA мотивов, наличие которых снижает в полтора раза время жизни мРНК LOSK и, соответственно, синтез данного белка. (Cybulsky et al., 2007). Таким образом, вероятно, в клетках ренального эпителия имеет место конститутивное подавление синтеза этой киназы. Что же касается регуляции активности LOSK другими сигнальными каскадами – по крайней мере, один механизм, фосфорилирование по серинам 347/348 казеинкиназой СK2, работает в клетках. Будучи фосфорилированной по этому сайту, протеинкиназа LOSK переходит в неактивное состояние, в котором регуляторная С-концевая часть молекулы ингибирует конститутивно-активный каталитический N-концевой домен киназы (Chaar et al., 2006) .

Протеинкиназа LOSK присутствует во всех тканях взрослого организма, однако, во время эмбрионального развития её синтез происходит преимущественно в нервной и мышечной тканях. Экспрессия LOSK особенно выражена в сателлитных клетках поперечнополосатой мускулатуры и в синаптических окончаниях нервных волокон. Также было показано, что подавление её активности препятствует слиянию нормальных миобластов С2С12 в миотубулы (Sabourin and Rudnicki, 1999; Zhang et al., 2002; Storbeck et al., 2004) .

На сегодняшний день известно, что LOSK может активировать с-Jun N-концевую киназу (JNK, c-Jun N-terminal kinase) (Sabourin and Rudnicki, 1999; Sabourin et al., 2000), р38 митогенактивированную протеинкиназу (Hao et al., 2006), а также обеспечивать трансактивацию p53 (Cybulsky et al., 2009). Помимо этого, LOSK фосфорилирует одну из киназ, участвующую в апоптотического сигнальном каскаде – ASK-1 (apoptosis signal-regulating kinase), увеличивая, таким образом, её активность (Hao et al., 2006). Суммируя вышеизложенные данные, можно резюмировать, что одной из важнейших функций LOSK является регуляция клеточной гибели .

На ранних этапах апоптоза киназа LOSK расщепляется каспазой 3. После расщепления LOSK образуются два функциональных домена: активированный N-концевой домен киназы, способный запускать апоптоз и С-концевой домен, возможно, инициирующий разборку актиновых стресс-фибрилл (Sabourin et al., 2000). Развитие апоптоза, вероятно, идёт по митохондриальному пути, так как в качестве субстрата для LOSK может выступать проапоптотический белок Bcl-2 (B-cell lymphoma 2) (Потехина, 2003). Однако экспрессия полноразмерной киназы может приводить к апоптотической гибели клеток вне зависимости от каталитической активности LOSK (Sabourin et al., 1999), поэтому механизм индукции апоптоза при участии LOSK на данный момент ещё не окончательно расшифрован .

Во время прохождения клетки по клеточному циклу активность протеинкиназы LOSK увеличивается в G2-фазе и, вероятно, способствует последующей активации киназы Plk1 (Ellinger-Ziegelbauer et al., 2000). Это может являться одним из ключевых моментов, определяющих вхождение клеток в митоз (O’Reilly et al., 2005) .

Ещё одним процессом, происходящим под контролем протеинкиназы LOSK, является клеточная подвижность. При направленной миграции клеток в рану монослоя происходит концентрирование активной киназы на переднем крае клеток, что является существенным для обеспечения нормальной динамики фокальных контактов, а также для передачи сигнала от FAK/с-Src (Focal Adhesion Kinase/cellular-Src (Sarcoma)) комплекса внутрь клетки (Wagner et al., 2008). Также было показано, что ингибирование LOSK приводит к нарушениям миграции опухолевых эпителиальных клеток молочной железы. Иниициатором передачи сигнала выступает тирозинкиназный рецептор HER2/ErbB2/Neu (human epidermal growth factor receptor 2/ erythroblastosis oncogene B/neural glioblastoma), при аутофосфорилировании которого по тирозинам 1201 или 1226/7 происходит активация LOSK (Roovers et al., 2009). Ингибирование LOSK также приводит к нарушениям локомоторной активности фибробластоподобных клеток (Бураков и Надеждина, 2010) .

Ещё одной важной функцией LOSK является ремоделирование цитоскелета. Например, повышенная её активность способствует разборке актиновых стресс-фибрилл (Wagner et al., 2002). В то же время активность LOSK необходима для обеспечения радиальной организации микротрубочек в интерфазных клетках: её нокдаун или ингибирование активности приводят к дезорганизации системы микротрубочек (рисунок 10б), однако не влияют на стабильность самих микротрубочек и центросомы, а также на динамику микротрубочек и морфологию аппарата Гольджи (Burakov et al., 2008а). Видимо, основной эффект LOSK на движение клеток опосредован перестройками цитоскелета в мигрирующих клетках, что подтверждается преобладанием цитоскелетных белков среди субстратов этой протеинкиназы .

К настоящему моменту точно определены несколько субстратов LOSK. Среди них можно выделить компонент динактинового комплекса – белок p150Glued. Его длинная изоформа, 1А (Zhapparova et al., 2009), фосфорилируется по одному или нескольким треонинам 145-147 внутри вариабельного участка белка (рисунок 3г). Именно этот механизм вносит вклад в организацию микротрубочек в интерфазных клетках; скорее всего нарушение Glued фосфорилирования 1А-изоформы белка приводит к дезорганизации p150 микротрубочкового цитоскелета на фоне ингибирования активности LOSK (Жаппарова, 2008, Zhapparova et al., 2013) .

Также LOSK фосфорилирует малую ГТФазу RhoA по серину 188, что способствует связыванию RhoA с её ингибитором GDI, препятствующему активации ГТФазы (рисунок 5) .

Этот механизм работает в гладкомышечных клетках стенок сосудов, приводя, в конечном счёте, к их расслаблению (Guilluy et al., 2008) .

Ещё одним субстратом протеинкиназы LOSK является паксиллин. Он представляет собой небольшой (68 кДа) адаптерный белок, локализованный преимущественно в фокальных контактах. Было показано, что LOSK фосфорилирует паксиллин по серину 250, что необходимо для обеспечения динамичной сборки/разборки фокальных контактов и, в конечном счёте, клеточной миграции (Quizi et al., 2012) .

Недавно было обнаружен ещё один субстрат LOSK – белок эзрин, который подвергается двухминутным циклам фосфорилирования/дефосфорилирования по треонину 567 при участии киназы и родственной ей kinase). В отсутствие LOSK LOK (lymphocyte-oriented фосфорилирования нарушается образование содержащих актин микроворсинок (Viswanatha et al., 2012). Также LOSK фосфорилирует родственные эзрину белки моэзин и радиксин по треонинам 558 и 564 соответственно. Фосфорилирование всех 3-х ERM белков необходимо для правильной ориентации веретена деления в митозе (Machicoane et al., 2014) .

Суммируя всё вышесказанное, можно заключить, что, хотя число известных мишеней LOSK невелико, данная протеинкиназа принимает участие в большинстве ключевых процессов жизнедеятельности клетки, таких как прохождение клетки по клеточному циклу, запуск программируемой клеточной гибели и дифференцировка клеток, а также ремоделирование цитоскелета и регуляция клеточной подвижности. В настоящей работе большее внимание будет уделено участию LOSK в регуляции двух последних процессов: организации цитоскелета и движения клеток .

–  –  –

Для всех эукариотических клеток характерно наличие цитоскелета. В животных клетках он представлен тремя видами нитевидных белковых полимеров: микрофиламентами, промежуточными филаментами и микротрубочками .

–  –  –

Микротрубочки представляют собой полые структуры, построенные из белка тубулина и имеющие диаметр 25 мкм (рисунок 2). Функция микротрубочек заключается в том, что они создают некий каркас, «рельсы», для передвижения по ним различных внутриклеточных компонентов, таких как везикулы и даже целые органеллы; они обеспечивают также расхождение хромосом во время митоза. Микротрубочки выполняют также структурную функцию в клетке, участвуя в сохранении её морфологии и расположения органелл, в том числе, поддерживая сложную форму нейронов. Кроме того, микротрубочки важны для образования сложных подвижных структур - жгутиков и ресничек .

В основе организации каждой микротрубочки лежит димер белка тубулина, состоящий из двух сходных, но не идентичных глобулярных субъединиц: –тубулина и –тубулина, массой около 50 кДа каждая. При наличии ГТФ происходит полимеризация димеров тубулина в протофиламент, участвующий затем в латеральных взаимодействиях. Это приводит к образованию листа, который замыкается в трубочку, состоящую из 13-ти протофиламентов .

При благоприятных условиях трубочка способна расти своим, так называемым, «плюс» концом, на котором находится -тубулин. Противоположный конец содержит –тубулин: он склонен к быстрой разборке в физиологических условиях, и поэтому его называют «минус»концом (Nogales, Wang, 2006). При относительно невысоких концентрациях свободного тубулина в цитоплазме, наблюдаемых на краю клетки, плюс-конец микротрубочки, как правило, динамичен: он способен к медленному росту и быстрому укорочению («катастрофе»), которое может смениться повторным ростом («спасением»), либо привести к полной разборке микротрубочки .


Это явление получило название динамической нестабильности (рисунок 2) (Mitchison, Kirschner, 1984). Большинство микротрубочек в клетке нестабильно, однако обычно существует небольшой процент стабильных, нединамичных микротрубочек. Возможно, это связано с тем, что в их составе значительно больше посттрансляционно модифицированного (ацетилированного и детирозилированного) тубулина (Bulinski, Gundersen, 1991) .

Рисунок 2. Структура и динамика микротрубочек (Conde and Cceres, 2009, сизменениями) .

Другой тип поведения микротрубочек, тредмиллинг (от англ. «treadmill» – конная мельница), наблюдается в узком интервале концентрации свободного тубулина, значительно более высокой, чем при динамической нестабильности. При тредмиллинге происходит псевдопередвижение микротрубочки при полимеризации на её плюс-конце и разборке минус– конца. Модель тредмиллинга была предложена первоначально при попытке описать динамику микротрубочек и актиновых филаментов в 1976 году, но in vivo тредмиллинг был показан экспериментально только в 1988 году (Walker et al., 1988, Kueh, Mitchison, 2009) .

На сегодняшний день известно множество веществ, влияющих на свойства микротрубочек. Особенно широко в исследованиях в области клеточной биологии используются растительный алкалоид колхицин, его синтетический аналог – колцемид, а также ещё один синтетический агент - нокодазол. Эти вещества, связываясь с -субъединицей тубулина, препятствуют нормальной динамике микротрубочек, приводя к их разборке (Luduena and Roach, 1991; Xu et al., 2002; Modriansk, Dvork, 2005) .

Белки, ассоциированные с микротрубочками (МАР) 3.2.1.1 .

Важную роль в динамике микротрубочек играют MAP-белки (microtubule associated proteins), которые, связываясь с микротрубочкой, регулируют её состояние. Общепринятой классификации МАР белков не существует, зачастую их делят на группы в зависимости от особенностей их связывания с микротрубочкой.

Существуют МАР-белки, которые:

- могут связываться по всей длине микротрубочки,

- связываются с концами микротрубочки, тем самым стабилизируя или дестабилизируя её,

- белки с особыми функциями (например, «разрезающие» микротрубочку белки) .

Среди белков, связывающихся с «плюс» концом микротрубочки, достаточно хорошо охарактеризованы EB1 и EB3 (End Bounding) – небольшие белки, массой около 35 кДа, имеющие высокую степень гомологии в клетках различных организмов. EB1 и EB3 специфически связываются с растущим концом микротрубочки, регулируя его динамику (Tirnauer, Bierer, 2000). При наличии в клетках меченых белков семейства ЕВ1/3 можно наблюдать «кометы», «вылетающие» из центров, в которых происходит затравка роста новых микротрубочек, т.е. рост микротрубочек на их плюс-концах (рисунок 23в) (Mimori-Kiyosue et al., 2000). Ещё одними плюс-концевыми белками, влияющими на динамику микротрубочек, являются CLIPs (Cytoplasmic Linker Proteins) и CLASPs (CLIP-Associated Proteins). Образуя сложный комплекс на растущем конце микротрубочки, CLASP и CLIP белки снижают вероятность катастроф в динамике микротрубочек, способствуя их стабилизации. Кроме того, эти белки могут участвовать в прикреплении микротрубочек к мембранам. Находясь на растущем конце микротрубочки, CLASPs способны связываться с кластерами LL5 - PI3P– связывающих белков, расположенных на клеточном кортексе (Galjart, 2005, Lansbergen et al., 2006; Bratman,Chang, 2008). С другой стороны, связаные с аппаратом Гольджи CLASPs могут обеспечивать удержание микротрубочек на нём (Mimori-Kiyosue et al., 2005; Efimov et al., 2007) .

–  –  –

Моторные белки составляют отдельную группу белков, которые могут связываться с микротрубочкой по всей её поверхности и двигаться в направлении её плюс или минус-конца, генерируя энергию для движения за счёт гидролиза АТФ. Именно моторные белки выполняют функцию основного переносчика внутриклеточных компонентов .

В клетках существуют 2 группы моторных белков микротрубочек – кинезины и динеины .

На данный момент охарактеризовано, по крайней мере, 14 семейств кинезинов, с различным количеством лёгких и тяжёлых цепей в их составе и с различным расположением моторного домена (Lawrence et al., 2004). Большинство кинезинов являются олигомерными молекулярными комплексами, имеющими моторный домен на N-концевом участке тяжёлой цепи: такие кинезины способны перемещаться по микротрубочке в сторону её плюс-конца .

Также существует минус-концевой кинезин, имеющий моторный домен на С-конце. Наиболее изученным является кинезин-1: он является основным плюс-концевым мотором в большинстве клеток. Кинезин-1 представляет собой гетеротетрамерный комплекс, состоящий из двух тяжёлых – основных его функциональных цепей и двух лёгких – регуляторных, которые также участвуют в связывании кинезина с различным грузом (Marx et al., 2005) .

Динеины – второй класс моторных белков, связанных с микротрубочками. Существует около 15-ти видов динеинов, из них только 2 выполняют свои функции в цитоплазме клеток – «цитоплазматические» динеины, остальные же участвуют в движении ресничек и жгутиков – «аксонемные» динеины. Характерной особенностью динеинов является то, что все они – минусконцевые белки: гидролизуя АТФ, они перемещаются в сторону минус-конца микротрубочки .

Динеин-динактиновый комплекс 3.2.1.3 .

Динеин I является основным минус-концевым моторным белком во всех животных клетках. Он представляет собой мультисубъединичный комплекс с общей массой 1,5 МДа. В его состав входят 2 тяжёлые цепи, 3 промежуточные, 4 лёгкие промежуточные и несколько лёгких. В функциональном отношении тяжелые цепи (DHC) являются основными: мономерные DHC способны передвигаться по микротрубочке. Остальные цепи несут регуляторные функции .

Для перемещения динеина по микротрубочке на большие расстояния ему необходим мультисубъединичный адапторный комплекс – динактин. Считается, что без динактинового комплекса динеин способен к передвижению по микротрубочке, но процессивность такого бездинактинового комплекса сильно снижена (King and Schroer, 2000). Однако, в опытах in vitro было показано, что процессивность динеина в отсутствие динактина может быть восстановлена повышением концентрации АТФ в растворе (Walter et al., 2010). Кроме этого, динактин участвует в связывании динеина с различными грузами (Schroer, 2004). В связывании динеиндинактинового комплекса с грузами и в его посадке на микротрубочку также могут принимать участие и другие белки - BICD2 (Bicaudal D2), Lis1 (lissencephaly 1) или NudE. Участие какоголибо из этих дополнительных кофакторов значительно увеличивает процессивность динеиндинактинового комплекса (Li et al., 2005; Splinter et. al., 2012; Wang et al., 2013) .

В составе динактинового комплекса выделяют «плечо», состоящее из филамента октамера схожего с актином белка Arp1, кэпированного белками CapZ (Capping protein in muscle Z-line), Arp 11 и p62 и декорированного несколькими небольшими белками. Один из них

– динамитин/р50 обеспечивает связь с «рукой», представленной димером белка р150 Glued – самой большой из субъединиц динактина (рисунок 3а) (Schroer, 2004). При окрашивании клеток антителами к компонентам динактина в них можно наблюдать «плюс» концы микротрубочек:

здесь начинается связывание динеин-динактинового комплекса с микротрубочкой, поскольку p150Glued имеет высокое сродство к плюс-концевым белкам EB1/3 и CLIP170 (Бураков и Надеждина, 2006; Lomakin et al., 2009). Кроме того, значительное количество динактина локализовано в центросоме, где он участвует в удержании микротрубочек (рисунок 3б) (Quintyne et al., 1999) .

Известно, что динеин-динактиновый комплекс связывается преимущественно с динамичными концами микротрубочек: главную роль в этом процессе играет взаимодействие р150Glued с плюс-концевыми белками микротрубочек (Duellberg et al., 2014). Также р150Glued совместно с CLIP-170 способствует инициации минус-концевого транспорта везикул (Lomakin et al., 2009). Наряду с такими белками, как EB1, CLIP-170 и CLASPs, р150Glued может также влиять на динамику плюс-конца микротрубочки, способствуя её процессивному росту и снижая частоту катастроф. Мутации в белке р150Glued, препятствующие ему регулировать динамику микротрубочек, характерны для некоторых нейродегенеративных заболеваний (Lazarus et al., 2013; Stockmann et al., 2013). Более того некоторые мутации в этом белке, нарушающие его связывание с микротрубочками, непосредственно приводят к этим заболеваниям, например, к одной из разновидностей паркинсонизма – синдрому Перри (Ishikawa et al., 2014) .

На N-конце р150Glued расположен глобулярный Cap-Gly-домен (Cytoskeleton Associated

– имеющий сходную структуру у многих ассоциированных с Protein Gly-rich), микротрубочками белков (рисунок 3а, 3г) (Steinmetz and Akhmanova, 2008). Он отсутствует у короткой изоформы, характерной для нервной ткани – белка р135 (Lazarus et al., 2013). За CapGly-доменом следует основный или Basic-домен, Оба этих участка могут взаимодействовать с микротрубочками: basic-домен способен диффундировать вдоль микротрубочек, в то время как Cap-Gly-домен препятствует такой диффузии (Culver-Hanlon et al., 2006; Wang et al., 2014). В составе молекулы р150Glued также имеются 2 суперспиральных coiled-coil домена. В составе первого из них, СС1, выделяют два субдомена – CC1A и CC1B (рисунок 3г). Домен СС1B связывается с динеином и способен увеличивать процессивность динеина. СС-1А домен, наоборот, оказывает сильное ингибирующее действие на комплекс динеина и СС-1В (Tripathy et al., 2014). При экспрессии же полноразмерного участка р150Glued - СС1 в клетках происходит полное ингибирование активности динеина (Бураков и Надеждина, 2006) .

–  –  –

динактинового комплекса в клетках Vero при помощи антител к белку р150Glued. (3в) Локализация в клетках Vero GFP-слитых 1А и 1B-изоформ белка р150Glued (Zhapparova et al., 2009, с изменениями). (3г) Доменная структура р150Glued и генетические конструкции р150Glued, используемые в работе. Указаны вариабельный участок, отсутствующий у изоформы 1B, а также CAP-Gly-домен, основный микротрубочкосвязывающий домен (BMBD) и два домена, содержащих структуру скрученной спирали (СС) (Zhapparova et al., 2009, с изменениями) .

Как уже было сказано, протеинкиназа LOSK может фосфорилировать белок р150Glued. Его длинная 1А-изоформа фосфорилируется внутри участка в 20 аминокислот, отсутствующего у его мажорной, более короткой изоформы 1В (рисунок 3г). Также было выяснено, что р150 Glued-1А имитирующий фосфорилирование по этому сайту аналог способен восстанавливать радиальную систему микротрубочек, нарушаемую ингибированием протеинкиназы LOSK. В то же время нефосфорилируемый его аналог сам по себе нарушал организацию микротрубочек в клетках. Учитывая, что у имитирующего фосфорилирование Nконцевого участка р150Glued - 1А сродство к микротрубочками значительно ниже, чем у нефосфорилируемого, логично предположить, что фосфорилирование белка р150Glued киназой LOSK имеет значительную физиологическую роль, регулируя взаимодействие белка р150Glued с микротрубочками (Жаппарова, 2008; Burakov et al., 2008а; Zhapparova et al., 2009) .

Центр организации микротрубочек 3.2.2 .

Морфологически во многих клетках животных микротрубочковый цитоскелет выглядит как множество почти прямых «нитей», фибрилл, сходящихся в единый центр, расположенный вблизи ядра, называемый центром организации микротрубочек (ЦОМТ).

В большинстве клеток во время интерфазы имеется только один ЦОМТ, но во время митоза происходит его удвоение:

имеется 2 фокуса схождения микротрубочек, расположенных на полюсах клетки. Обычно в животной клетке ЦОМТ представлен центросомой с окружающим её перицентриолярным материалом (рисунок 4) .

–  –  –

В состав центросомы входят 2 центриоли – материнская и дочерняя, которая появляется при удвоении материнской. Они имеют цилиндрическую форму и расположены перпендикулярно друг другу. В составе каждой из центриолей находятся 9 триплетов микротрубочек, располагающиеся по её краю, по центральной оси центриоли проходит так называемая втулка. 9-кратная симметрия каждой из центриолей достигается благодаря образованию олигомерного комплекса, состоящего из девяти гомодимеров белка SAS-6 (spindle assembly 6 homolog) при закладке процентриолей (Kitagawa et al., 2011). Синглетные микротрубочки A, образующиеся первыми при закладке процентриолей, имеют 13 протофиламентов в своём составе, В и С-трубочки, примыкающие вплотную друг к другу, содержат по 10 протофиламентов. На микротрубочке А находятся так называемые «ручки», соединяющие её с микротрубочкой С соседнего триплета (Szollosi, 1964; Vorobjev and Chentsov, 1980) .

Дочерняя и материнская центриоли, находясь в связанном состоянии, различны структурно и функционально. На поверхности материнской центриоли находятся различные структуры - придатки и сателлиты, отсутствующие у дочерней центриоли; в то же время материнская центриоль функционально более активна в качестве организатора системы микротрубочек: большая часть микротрубочек в клетке отрастает именно от материнской центриоли (Vorobjev and Chentsov, 1982). Строго говоря, во время интерфазы рост новых микротрубочек происходит вблизи перицентриолярного материала, окружающего обе центриоли, но удерживаются микротрубочки на сателлитах материнской центриоли (Vorobjev and Chentsov 1982; Piel et al., 2000). При точечном выжигании лазером дочерней центриоли, она может восстановиться, при выжигании же материнской центриоли произойдёт дегенерация дочерней центриоли и перицентриолярного материала (Loncarek et al., 2008) .

При анализе центросомы с помощью метода масс-спектрометрии в ней обнаруживаются более пятисот различных белков (Andersen et al., 2003).

Среди наиболее изученных центросомальных белков можно выделить:

- структурные белки:,, – тубулины, центрин, перицентрин, сенексин, AKAP450, EB1, CLASP 1, 2, PCM 1 (pericentriolar material) и другие,

- сигнальные белки: Cdc2 (cell division protein), множество протеинкиназ, из них известны серин-треониновые (Nek2, Sak, SLK), cAMP – зависимые киназы, казеин киназа, киназа гликоген синтазы (GSK-3 изоформа),

- белки теплового шока: Hsp90, Hsp73 (Schatten, 2008; Узбеков и Алиева, 2013) .

Роль центросомы в организации микротрубочек 3.2.2.2 .

Роль центросомы, как организатора микротрубочек заключается в том, что на ней происходит затравка новых, активно полимеризующихся, микротрубочек, иначе – нуклеация .

Кроме того, на центросоме удерживаются и определённым образом закрываются способные к быстрой спонтанной разборке минус-концы микротрубочек: так называемые процессы заякоривания и кэпирования концов микротрубочек. Таким образом, центросома является органеллой, совмещающей в себе функции нуклеации, заякоривания и кэпирования микротрубочек, что является основными свойствами центра организации микротрубочек .

За нуклеацию микротрубочек на центросоме отвечают белковые комплексы -TuRC - tubulin ring complex (Zheng et al., 1991; Moritz et al., 1995, Pereira & Schiebel, 1997). Каждый TuRC состоит из нескольких -TuSC ( -tubulin small complex) и нескольких дополнительных белков - GCP4, 5 и 6 ( –tubulin complex protein). В составе же -TuSC лежит димер –тубулина связанный с двумя белками - GCP2 и GCP3. Наиболее вероятной является модель участия TuRC в нуклеации микротрубочек, согласно которой молекулы – тубулина в составе -TuRC образуют кольцо, являющееся основанием микротрубочки, поскольку микротрубочки, собранные внутри клетки, всегда состоят из 13-ти протофиламентов (Travesa et al., 2012). Кроме нуклеирования микротрубочек, -TuRC может участвовать в кэпировании минус-концов микротрубочек, защищая уже собранную микротрубочку от разборки с её минус-конца (Bornens, 2002, Travesa et al., 2012). Однако, при РНК-интерференции – тубулина нуклеация микротрубочек в может по-прежнему происходить в клетках; в таком случае нарушается общая организация микротрубочек, структура центросомы, а также наблюдаются дефекты веретена деления (O'Toole et al., 2012) .

В привлечении –тубулин-содержащих комплексов на центросому принимает участие белок AKAP450 (A-kinase anchoring protein), изначально описанный под названием CG-NAP (centrosome and Golgi localized PKN-associated protein). Этот белок находится в центросоме в течение всего клеточного цикла и, по крайней мере, во время интерфазы локализуется на аппарате Гольджи. Эндогенный AKAP450 формирует комплексы с белками -TuSC: – тубулином, GCP2 и GCP3. Кроме того, антитела против AKAP450, введённые в клетку, нарушают нуклеацию микротрубочек на центросоме. Эти данные свидетельствуют о том, что белок AKAP450 нужен для удержания комплексов -TuRC на центросоме (Takahashi et al., 1999, Takahashi et al., 2002). Схожие функции выполняет найнеин-подобный белок (Nlp), способный удерживать на центросоме -TuRC (Casenghi et al., 2003) .

Перицентрин - ещё один из компонентов перицентриолярного матрикса. Этот белок схож по своим функциям с AKAP450: он также способен взаимодействовать с протеинкиназой А (Diviani et al., 2000), а основная его роль, по-видимому заключается в привлечении – тубулиновых комплексов на центросому. Деплеция этого белка приводит к серьёзным нарушениям организации микротрубочек как в интерфазных, так и в митотических клетках (Delaval and Doxsey, 2010). И перицентрин, и AKAP450 содержат на С-конце консервативный участок в 90 аминокислот, получивший название PACT-домен (pericentrin-AKAP450 centrosomal targeting), который отвечает за их центросомную локализацию. Было показано, что при создании генетической конструкции, кодирующей ген GFP, слитого с последними 266 аминокислотами AKAP450 или перицентрина, обеспечивается центросомная локализация GFP (Gillingham and Munro, 2000) .

Активность же самого динеина, как кажется, не влияет на способность центросомы нуклеировать новые микротрубочки. Известно, что при ингибировании динеина частота нуклеации микротрубочек на центросоме остаётся неизменной, однако, при окраске на /тубулин в таких клетках можно будет наблюдать полностью разрушенную радиальную систему микротрубочек, несмотря на сохранение на центросоме таких белков как -тубулин и найнеин (Burakov et al., 2008). Однако, поскольку доставка на центросому найнеина зависит от динеинового транспорта, в долгосрочной перспективе ингибирование динеина может приводить к истощению пула найнеина на центросоме, а, следовательно, и снижать количество центросомных -TuRC .

Что же касается заякоривания микротрубочек - одним из участников этого процесса является белок найнеин. Этот фибриллярный белок способен образовывать олигомеры, локализованные в центросоме на субдистальных придатках материнской центриоли. Находясь на центросоме, найнеин ассоциирован с минус-концами микротрубочек (Mogensen et al., 2000) .

Кроме того, наличие найнеина на центросоме необходимо для удержания -TuRC: С-конец этого белка определяет его центросомную локализацию, а N-конец взаимодействует с -TuRC (Delgehyr et al., 2005). Центросома, несомненно, является ключевой фигурой в процессах нуклеации, кэпирования и заякоривания микротрубочек, но то, как эти процессы сочетаются друг с другом пока не совсем ясно. Остаётся ли микротрубочка в связанном с -TuRC состоянии после нуклеации или его заменяет какой-то другой белковый комплекс, на каком этапе жизни микротрубочки найнеин начинает её удерживать на центросоме, наконец, не являются ли нуклеация, кэпирование и заякоривание микротрубочек разными сторонами одного процесса?

Так что на сегодняшний день центросома ещё хранит в себе множество тайн .

Кроме найнеина, для удержания микротрубочек на центросоме необходима активность динеина и наличие правильно собранного динактинового комплекса. (Quintyne et al., 1999, Бураков и Надеждина, 2006). Динактиновый комплекс, по-видимому, может доставляться к центросоме не только за счёт динеинового транспорта, но и связываться напрямую с центросомными белками. Например, центросомный белок - Cep135, взаимодействуя с р50, определяет его центросомную локализацию, привлекая, скорее всего весь динактиновый комплекс на центросому (Uetake et al., 2004). Плюс-концевой белок EB1, взаимодействующий с р150Glued, также отчасти локализуется на центросоме. Таким образом, он способствует не только связыванию р150Glued с динамичными концами микротрубочек, но и его центросомному местоположению (Askham et al., 2002). Сам же EB1 привлекается на центросому двумя другими белками: CAP350 (Centrosome-Associated Protein 350) и FOP (FGFR1 oncogene partner): при деплеции любого из них система микротрубочек в клетке нарушается (Yan et al., 2005) .

Рисунок Структура центросомы 2007, с 4. (Azimzadeh and Bornens, изменениями) .

Ещё одним участником процесса заякоривания микротрубочек на центросоме является белок обнаруженный как основной компонент центриолярных сателлитов, PCM-1, электронноплотных гранул, диаметром 70-100 нм, «разбросанных» вокруг центросомы. PCM-1 непосредственно взаимодействует с такими центросомными белками как центрин, перицентрин и найнеин: деплеция PCM-1 приводит к истощению пула этих белков на центросоме. Его доставка к центросоме, по-видимому, происходит непосредственно в составе перицентриолярных сателлитов и зависит от активности динеина и наличия динактинового комплекса (Kubo et al., 1999; Dammermann and Merdes, 2002; Kodani et al., 2010). В качестве адаптора, связывающего между собой PCM1 и p150Glued, выступает белок BBS4. При дефекте или отсутствии на клеточном уровне наблюдается нарушение организации BBS4 микротрубочек, дефекты центриолей и образования первичных ресничек. Было показано, что, находясь в основании первичной реснички, консервативный комплекс из семи BBS-белков взаимодействует с PCM-1. Вместе эти белки привлекают малую ГТФазу Rab8, ответственную за рост первичной реснички, через её фактор обмена гуаниновых нуклеотидов (GEF) – Rabin8 .

Нарушение нормального функционирования какого-либо из вышеперечисленных белков на организменном уровне, в конечном счёте, приводит к тяжёлым цилиопатиям. Например, дефекты BBS-белков приводят к синдрому Барде-Бидля, который характеризуется макулярной дистрофией, полидактилией, умственной отсталостью; отсюда эти белки и получили своё название (Bardet-Biedl syndrome) (Kim et al., 2004; Nachury et al., 2007; Jin et al., 2010). Недавно был обнаружен ещё один участник доставки PCM-1 на центросому, им оказался один из определяющих полярность клеток белков – Par6 (polarity protein 6 alpha): как и BBS4, он выступает в качестве адаптора, связывающего PCM-1 и p150Glued (Kodani et al., 2010). Cep290 (centrosomal protein 290) – ещё один из партнёров PCM-1, мутации в котором также ассоциированы с синдромом Барде-Бидля или с синдромом Жубер, характеризующимся недоразвитием мозжечка. Однако, как кажется, этот белок выступает скорее как негативный регулятор центросомной локализации PCM-1: деплеция Cep290 истощает цитозольный пул PCM-1, переводя его в связанное с центросомой состояние. Это также приводит к нарушению организации микротрубочек и образования первичных ресничек в клетках (Kim et al., 2008) .

Нарушение образования первичных ресничек также может быть опосредовано потерей киназой Plk-1 её центросомной локализации, которая обеспечивается PCM-1 (Wang et al., 2013) .

Регуляция организации центросомных микротрубочек протеинкиназами 3.2.2.3 .

Киназа GSK-3, описанная как белок, способный фосфорилировать и инактивировать гликоген-синтазу (Woodgett & Cohen, 1984), может локализоваться на центросоме, где она регулирует доставку компонентов -TuRC на центросому в митозе путём фосфорилирования белка GCP5. При ингибировании активности GSK-3 к полюсам веретена деления привлекаются большие количества компонентов -TuRC, что приводит к усилению нуклеации микротрубочек (Izumi et al., 2008). Также было показано, что GSK-3 фосфорилирует белок BICD (Bicaudal-D), который, находясь в центросоме в фосфорилированном состоянии, способен связываться с динеином. Кроме того, активность GSK-3 важна для доставки найнеина к центросоме в интерфазе, таким образом, эта киназа является ключевым регулятором заякоривания микротрубочек на центросоме (Fumoto et al., 2006). GSK-3 вместе с казеинкиназой - CK1 фосфорилируют белок -катенин, что может приводить не только к его протеосомной деградации, но и накоплению некоторых количеств белка на центросоме, что увеличивает её нуклеирующую способность (Liu et al., 2002; Huang et al., 2007) .

Протеинкиназа Nek7 способствует накоплению -TuRC на центросоме (Kim et al., 2007b), вероятно, через фосфорилирование белка GCP-WD (NEDD1) (Lders et al., 2006). Этот же белок может направляться на центросому при фосфорилировании киназами Nek9 и Plk1 (Sdelci et al., 2012). В то же время Plk1 вместе с киназой Nek2, фосфорилируя упомянутый выше белок Nlp по разным сайтам, препятствуют его ассоциации с центросомой, вероятно, нарушая его связь с динактиновым комплексом. Этот механизм активируется при подготовке клетки к митозу, для замещения Nlp иными -TuRC-связывающими белками (Casenghi et al., 2005; Rapley et al., 2005). Также из митотических киназ хорошо изучена Aurora A, она фосфорилирует белок TACC (Transforming acidic coiled coil). Фосфорилированный TACC в комплексе с XMAP215 (аналог CLASP – Xenopus microtubule associated protein) способен стабилизировать минус-концы микротрубочек на центросоме (Barros et al., 2005). Центросомная локализация же самих Plk1 и Aurora A в митозе обеспечивается активностью p58-изоформы циклин-зависимой киназы Cdk11 (Petretti et al., 2006) .

Таким образом, функции многих протеинкиназ, участвующих в организации микротрубочек, за исключением GSK-3, зачастую сводятся к поддержанию организации веретена деления в митозе тем или иным способом. Поэтому киназа LOSK представляет собой большой интерес для изучения, так как её роль в поддержании системы микротрубочек не ограничивается лишь стадией митоза. Хотя её активность необходима при вхождении клетки в митоз для активации упомянутой выше Plk1 (Ellinger-Ziegelbauer et al., 2000; O’Reilly et al.,

2005) и правильной организации веретена деления (Machicoane et al., 2014), тем не менее, LOSK выполняет свои функции на протяжении всего клеточного цикла, участвуя в поддержании радиальной системы интерфазных микротрубочек (Burakov et al., 2008а) .

–  –  –

Ярким примером бесцентросомной системы микротрубочек является самоорганизация радиальной системы микротрубочек в меланофорах рыб и в экспериментально полученных фрагментах этих клеток. Активность динеина способствует перемещению меланосом в сторону минус-концов микротрубочек к центру клеток, приводя в итоге к появлению агрегата меланосом в центре клетки. Кроме того, меланосомы способны нуклеировать новые микротрубочки: таким образом, в клетке формируется радиальная сеть микротрубочек, сходящихся минус-концами к геометрическому центру клетки. Было показано, что нуклеация микротрубочек на пигментных гранулах является динеин-зависимой (Vorobjev et al., 2001), более того, предполагается, что динеиновый комплекс может непосредственно нуклеировать микротрубочки (Malikov et al., 2004). Однако этот вопрос пока ещё является предметом обсуждений, так как известно, что, находясь в центросоме, динеин не принимает участия в нуклеации микротрубочек: при его ингибировании нуклеирующая активность центросомы не нарушается, хотя заякоривания микротрубочек не происходит (Zhapparova et al., 2007, Burakov et al., 2008) .

Организация микротрубочек без участия центросомы наблюдалась довольно давно в разных клетках. Один из примеров - организация микротрубочек на плазмалемме энтероцитов in situ: чаще всего минус-концы таких микротрубочек лежат апикально, а плюс-концы – базально, центросомные микротрубочки, как правило, в этом случае малочислены. Также в аксонах нервных клеток находятся пучки, состоящие из коротких микротрубочек, направленных своими минус-концами к перикариону. Тем не менее, во всех вышеперечисленных случаях центросома по-прежнему является источником микротрубочек .

Предположительно механизм появления нецентросомных микротрубочек заключает в себя их высвобождение из центросомы, например, с помощью белка катанина, и их дальнейший транспорт моторными белками или тредмиллинг (Abal et al., 2002; Bartolini and Gundersen, 2006) .

Участие аппарата Гольджи в организации микротрубочек 3.2.3.2 .

Аппарат Гольджи является обязательным компонентом всех эукариотических клеток .

Морфологически АГ выглядит как стопка плоских мембранных цистерн, трубок, везикул, расположенных вблизи ядра. Среди них выделяют: промежуточные везикуло-тубулярные структуры или ERGIC (endoplasmic reticulum-Golgi intermediate compartment), перемещающиеся между цистернами Гольджи и сайтами экспорта эндоплазматического ретикулума (ERES), собственно цистерны Гольджи и тубулярную сеть, примыкающая к транс-цистерне – TGN, trans-Golgi network (Glick, 2000) .

В лабораторной практике широкое применение получил макроциклический антибиотик, продуцируемый многими грибами – брефелдин А, используемый для разборки АГ в живой клетке. Показано, что при использовании BFA большинство маркёров АГ, таких как, например, маннозидаза II, обнаруживаются в ЭПР, исключая маркёры TGN, что свидетельствует о перераспределении большей части АГ в ЭПР. TGN, а, возможно, и транс-цистерна, остаются незатронутыми (Klausner et al., 1992) .

На мембранах АГ существуют белки, поддерживающие аппарат Гольджи в оформленном виде как совокупность цистерн, они закреплены в основном в периферической их части и регулируют слияние и отделение везикул от цистерн аппарата Гольджи. Было выяснено, что многие из них имеют на С-конце белка последовательность аминокислот, обладающих определенным сходством. Последовательность, названная GRIP-доменом (golgin-97, RanBP2alpha, Imh1p and p230/golgin-245), встречается во многих белках разных организмов, в частности в белках дрожжей, C.elegans и человека. С помощью создания конструкций, кодирующих GFP, слитый с С-концевой последовательностью этих белков, было показано, что GRIP-домен способен направлять GFP на мембрану аппарата Гольджи (Munro and Nichols, 1999; Brown et al, 2001) .

GRIP-домен таргетирует белки в короткие цистерны транс-Гольджи сети, очень динамичные участки АГ, где происходит активный транспорт везикул. GRIP-домен имеет вариабельную длину, но в среднем его размеры не превышают 100 аминокислот. Этот консервативный домен встречается у многих эукариот, в том числе и у простейших, таких как Trypanosoma brucei, Leishmania mexicana (Munro and Nichols, 1999; McConville et al., 2002) .

Некоторые белки, содержащие GRIP-домен, участвуют в организации транс-Гольджи субкомпартмента, регулируют мембранный транспорт, отделение везикул от цистерн (Luke et al., 2003). Белок Гольджин-97 локализуется на мембранах транс-Гольджи. Он принимает участие в регуляции ретроградного транспорта из этой области, а именно - в отпочковывании рециклирующих везикул - пузырьков без СОР-окаймления (Coated protein) (Jing et al., 2010) .

GRIP-домен этого белка, как было показано, обладает самым высоким сродством к мембранам АГ (Munro and Nichols, 1999) .

Достаточно давно было установлено, что структурная целостность аппарата Гольджи зависит от микротрубочек. При двойном иммуноцитохимическом окрашивании микротрубочек и аппарата Гольджи можно обратить внимание, что зачастую в клетках центр сети микротрубочек и АГ находятся очень близко друг к другу или даже совпадают. При воздействии на клетки химическими агентами, деполимеризующими микротрубочки, одновременно с разборкой микротрубочек в клетке наблюдается фрагментация стопок АГ, а затем – диспергирование их по цитоплазме клетки. Было показано, что везикулы диспергированного АГ распределены не случайно: они лежат в непосредственной близости к ERES - endoplasmic reticulum exit site (Cole et al. 1996). При восстановлении микротрубочек после их разборки везикулы АГ начинают двигаться вдоль микротрубочек к центру клетки, то есть, в сторону минус-концов микротрубочек, что говорит об участии минус-концевого моторного белка динеина в поддержании структуры АГ. Это предположение подтверждается тем, что при ингибировании динеина АГ всё время находится в диспергированном состоянии (Burkhardt et al., 1997; Thyberg & Moskalewski, 1999). Также, иммуноцитохимические окрашивания показывают совместную локализацию АГ и его везикул с динеином I и в некоторых случаях с динеином II (Allan et al., 2002) .

Как оказалось, плюс-концевые моторы также взаимодействуют с АГ: показана локализация кинезина I на АГ (Allan et al., 2002). Известно также, что при ингибировании кинезина в клетках с разобранным при помощью брефелдина А аппаратом Гольджи, перестаёт наблюдаться транспорт везикул АГ к ЭПР (Thyberg & Moskalewski, 1999). Кроме того, предполагается, что в поддержании структуры АГ может участвовать минус-концевой кинезин KIFC3 (kinesin family member C3) (Brownhill et al., 2009). Эти данные свидетельствуют о необходимости координации активности динеина и кинезина для поддержания структуры АГ и его локализации в клетке .

Сведения о связи АГ с актиновым цитоскелетом немногочисленны, однако, известно, что малые ГТФазы, такие как Arf1, Cdc42 и RhoA могут контролировать архитектуру АГ (Hehnly et al., 2010; Zilberman et al., 2011), и, наоборот, АГ может выступать платформой для работы некоторых ГТФаз (Baschieri et al., 2014) .

На сегодняшний день аппарат Гольджи рассматривается как альтернативный или дополнительный для центросомы ЦОМТ. В 2001 году была впервые показана нуклеация микротрубочек in vivo на АГ и in vitro на выделенных мембранах АГ при участии –тубулина .

Такие микротрубочки становились стабильнее центросомных благодаря повышенному содержанию в них ацетилированного тубулина (Chabin-Brion et al., 2001) .

На роль посредника, привлекающего –тубулин к поверхности АГ, претендовал уже упомянутый белок АКАР450, ассоциированный с центросомой и АГ (Takahashi et al., 1999, Takahashi et al., 2002). В действительности оказалось, что при его нокдауне –тубулин перестаёт локализоваться на АГ, но полностью не исчезает с центросомы, что ведёт к утере аппаратом Гольджи, но не центросомой, способности нуклеировать микротрубочки. Рекрутирование же АКАР450 на мембраны АГ происходит путём взаимодействия его с резидентным белком АГ – GM130. (Rivero et al., 2009), возможно, при участии динеин-динактинового комплекса (Kim et al, 2007). –тубулин также может рекрутироваться на мембраны АГ при помощи GMAP-210, белка, участвующего в поддержании структурной целостности АГ и его поляризации в мигрирующих клетках. В клетке GMAP-210 образует связи с комплексами, содержащими – тубулин. Связываясь с мембранами АГ, он может способствовать доставке –тубулина к цисГольджи в клетке (Rios et al., 2004; Yadav et al., 2009) .

Ещё одним участником образования АГ-зависимых микротрубочек оказался CLASP2, привлекаемый на транс-Гольджи гольджином GCC185. Этот же плюс-концевой белок (как считалось ранее) мог покрывать нецентросомные микротрубочки, тем самым стабилизируя их .

В отличие от центросомной системы микротрубочек, нуклеированные на АГ микротрубочки чаще всего были направлены в сторону ведущего края клетки, формируя ассиметричную сеть (Efimov et al, 2007). Сборке и удержанию нуклеирующего комплекса на АГ способствуют малые ГТФазы Rab6 (Ras-like GTP-binding protein) (Burguete et al., 2008) и ARL4A (ADPribosylation factor-like 4A) (Lin et al., 2011). В клетках, нокаутных по гену CLASP2, также резко снижалось количество микротрубочек, связанных с кортексом клетки. За связь микротрубочек с кортексом отвечает, по-видимому, тот же самый С-концевой домен CLASP2, который отвечает за его локализацию на аппарате Гольджи (Mimori-Kiyosue et al., 2005) .

Также с поверхностью цис-Гольджи связан белок секурин в его нефосфорилированной форме, где он взаимодействует с GM130, AKAP450, и -тубулином. При деплеции этого белка нарушаются процессы нуклеации нецентросомных микротрубочек, а также поляризации и миграции клеток (Moreno-Mateos et al., 2011). Такие же нарушения наблюдались при деплеции АКАР450/GM130 (Kodani & Sutterlin, 2007; Rivero et al., 2009) или CLASP2 (Drabek et al, 2006) .

Сигнальные пути, регулирующие организацию микротрубочек посредством АГ, на сегодняшний день слабо изучены. В них, возможно, участвуют киназы секурина: Cdc2 и ДНКзависимая киназа DNA-PK (DNA-dependent protein kinase) (Romero et al., 2001; Lewy et al., 2013). Также вышеупомянутая -изоформа киназы гликогенсинтазы-3 может локализоваться на мембранах транс-Гольджи сети. Одна из функций этого белка в аппарате Гольджи – модулирование взаимодействия белка CLASP2 с микротрубочками путём его фосфорилирования. При отсутствии активности GSK-3, находящейся в АГ, нарушается связь белка CLASP2 с микротрубочками, что ведёт к дестабилизации микротрубочек (Adachi et al, 2010). По крайней мере, фосфорилирование 2-х серинов – 533 и 537 - киназой GSK-3 является обязательным для локализации CLASP2 на АГ (Watanabe et al., 2009) .

Неизвестно, может ли киназа LOSK принимать участие в регуляции организации микротрубочек на АГ. Среди известных её субстратов лишь p150 Glued отчасти локализуется на аппарате Гольджи. Однако, находясь на АГ в составе динеин-динактинового комплекса, он, в принципе, может принимать участие в организации микротрубочек (Rivero et al., 2009). Кроме того, активность динеина необходима для локализации AKAP450 на АГ посредством его взаимодействия с p150Glued (Kim et al., 2007a). Таким образом, этот вопрос остаётся открытым .

Промежуточные филаменты 3.2.4 .

Промежуточные филаменты присутствуют только у высших эукариот. Сборка их значительно отличается от таковой для микротрубочек и актиновых филаментов и представляет собой многоэтапный процесс, в котором за счёт латеральных антипараллельных взаимодействий фибриллярных мономеров возникает 32-субъединичная неполярная структура, имеющая диаметр 10 нм и способная собираться в филамент. Тканеспецифичность и разнообразие промежуточные филаментов – ещё одно отличие их от микротрубочек и микрофиламентов. Кроме ядерных ламинов, присутствующих во всех клетках организма, существует обширная группа кератинов, характерных для эпителиальных клеток, нейрофиламенты, десмин-подобные белки, чаще обнаруживаемые в мезенхимальных клетках .

Промежуточные филаменты являются чрезвычайно прочными структурами, обеспечивающими способность клетки противостоять деформации (Herrmann et al., 2007). Несмотря на это, промежуточные филаменты очень динамичны и подвергаются в физиологических условиях постоянной сборке и разборке, в некоторых случаях, коррелирующими с соответствующими процессами, происходящими с системой микротрубочек (Martys et al., 1999). Однако, как кажется, имеет место и обратный процесс: виментиновые виламенты могут стабилизировать плюс-концы микротрубочек, что способствует эффективной, направленной клеточной миграции (Gan, 2014) .

Актиновые филаменты 3.2.5 .

Микрофиламенты – самые тонкие элементы цитоскелета, их диаметр составляет примерно 7-8 мкм, основным белком, входящим в их состав, является актин. Актиновые филаменты, как и микротрубочки, формируются при полимеризации мономеров глобулярного актина (G-актина) по принципу «голова к хвосту», образуя полярные структуры, где также можно выделить плюси минус-конец (Pollard and Borisy, 2003). Полимеризация актина является АТФ-зависимой, её скорость определяется нуклеацией, лимитирующей стадией полимеризации. При объединении нескольких мономеров образуется структура, способная удлиняться (Welch and Mullins, 2002) .

Сформированный микрофиламент состоит из двух протофиламентов, закрученных в правую спираль. В отличие от микротрубочек, для которых основным способом поведения является динамическая нестабильность, актиновые филаменты чаще демонстрируют тредмиллинг, нарастая с плюс-конца и разбираясь с минус-конца (Carlier, 1998) .

Несмотря на то, что в основе организации микрофиламентов лежит всего несколько изоформ глобулярного белка G-актина, число различных структур, образуемых им, а также процессов, в которых он принимает участие, очень велико. В клетке актиновые микрофиламенты образуют сети или пучки за счет взаимодействия с разнообразными актинсвязывающими белками. Такие взаимодействия могут инициировать ветвление или перекрёстное расположение микрофиламентов, образование различных сократимых или несократимых структур с параллельной или антипараллельной укладкой филаментов (Blanchoin et al., 2014) .

Существуют моторные белки, миозины, способные перемещаться вдоль актиновых филаментов и переносить определённые грузы. Большинство миозинов способны передвигаться в сторону плюс-конца филамента, хотя существуют и минус-концевые миозины VI и IX (Inoue et al., 2002; Wells et al., 1999). Обычно миозин состоит из одной или двух тяжёлых цепей, «голова» которых обладает каталитической АТФазной активностью, «хвост»

же участвует в регуляторных взаимодействиях и димеризации цепей. Через дополнительные лёгкие цепи, которые также участвуют в регуляции активности миозина, он связывается с карго. Таковым, например, является миозин V (Cheney et al., 1993), который считается одним из основных участников везикулярного транспорта. «Одноголовый» миозин I, как и миозин V, принимает участие в перемещении внутриклеточных компонентов, в частности, в экзо- и эндоцитозе (Mermall et al., 1998) .

«Двухголовый» немышечный миозин II (известный как conventional myosin) также участвует в процессах транспорта внутри клеток, например, регулируя отпочковывание везикул от аппарата Гольджи или интернализацию клеточных рецепторов (Stow et al., 1998; Kim et al., 2012). В то же время он необходим для прохождения цитокинеза, выполняя сократительную функцию при делении клеток (Pollard et al., 1990). Он также принимает участие в образовании и функционировании других актин-содержащих структур в клетке, таких как стресс-фибриллы;

кроме того миозин II организует клеточный кортекс (Blanchoin et al., 2014). Сократительные функции миозин II выполняет в составе сложно организованного биполярного филамента, который может быть собран из различных изоформ этого белка (Shutova et al., 2014) .

Регуляция активности миозина может осуществляться различными способами, такими как, например, экспрессия различных его изоформ, отличающихся по своей каталитической активности; но, видимо, основная регуляция осуществляется через фосфорилирование лёгких регуляторных цепей миозина. В этот процесс вовлечены MLCK или киназа лёгких цепей миозина (Мyosin light chain kinase), p160ROCK (Rho-associated protein kinase), цитрон киназа (Сitron), MRCK (Мyotonic dystrophy kinase-related Cdc42-binding kinase), ZIP-киназа (ZipperCa2+-зависимое interacting protein). Чаще всего для активации миозина необходимо фосфорилирование по соседним треонину 18 и серину 19 его лёгких цепей какой-либо из этих протеинкиназ (Watanabe et al., 2007). Также миозин может фосфорилироваться протеинкиназой С по сайтам Ser1/Ser2/Thr9, но физиологическая роль этого процесса до конца не ясна (Beach et al., 2011) .

3.3. Малые ГТФазы

Малые ГТФазы или ГТФазы суперсемейства Ras (от «Rat sarcoma») представляют собой небольшие белки, размером около 21кДа, работающие в качестве молекулярных переключателей.

Под их контролем находится большинство внутриклеточных процессов:

пролиферация, клеточная гибель, дифференцировка, организация цитоскелета, везикулярный транспорт и многие другие .

С неактивной малой ГТФазой связан гуанозин дифосфат (ГДФ), при участии специальных белков-посредников GEFs (guanine nucleotide exchange factors) он заменяется на ГТФ (Schmidt and Hall, 2002). Этот процесс сопровождается «включением» малой ГТФазы при изменении её конформации. В таком состоянии ГТФаза способна активировать эффекторные белки, которые участвуют в дальнейшей передаче сигнала. (GTPase-activating GAP-белки proteins) стимулируют процесс гидролиза ГТФ в составе белковой молекулы до ГДФ, способствуя, таким образом, «выключению» малой ГТФазы (Bernards, 2003). Ещё один особый класс белков, участвующий в регуляции малых ГТФаз – GDIs (guanine dissociation inhibitors), они ингибируют диссоциацию ГДФ-нуклеотида, связанного с белком. В связанном с GDIs состоянии, малые ГТФазы образуют цитоплазматический пул неактивных белков. Последующее «включение»

ГТФазы происходит только после диссоциации GDIs (рисунок 5) (Dransart et al., 2005) .

Все представители суперсемейства Ras претерпевают посттрансляционные модификации, необходимые для их локализации на различных клеточных мембранах. Наиболее характерной модификацией является пальмитоилирование по С-концу белка, но также встречаются и другие, такие как изопренилирование, фарнезилирование и т. д. (Newman and Magee, 1993; Liu et al., 2012). Таким образом, действие малых ГТФаз и регуляция их активности протекает в тесной связи с мембранами клетки .

У млекопитающих выделяют 5 семейств малых ГТФаз: Ras, Rho, Rab, Arf (ADPribosylation factor), и Ran (Ras-related nuclear protein), в зависимости от их биологических функций и гомологии. Белки семейства Ras регулируют клеточную пролиферацию, Rho – морфологию клетки, Rab и Arf– везикулярный транспорт, а белки семейства Ran ответственны за ядерный транспорт (Boureux et al., 2007) .

В семействе Rho наиболее изученными являются RhoА (Ras homologous member A), Rac1 (Ras-related C3 botulinum toxin substrate 1) и Cdc42 (cell division cycle 42). Каждый из них принимает участие в передаче сигнала от мембранных рецепторов, приводя к реорганизации актинового цитоскелета (Hall, 2005). Cdc42 играет важную роль в регуляции клеточной полярности и подвижности клеток млекопитающих. Она влияет на образование высокодинамичных пальцеподобных выростов мембраны, филоподий, состоящих из паралелльных пучков F-актина и необходимых для восприятия внешних сигналов (Heasman and Ridley, 2008). Образование таких пучков актина происходит при активации нуклеатора актина WASP (Wiskott–Aldrich syndrome protein) и комплекса Arp2/3 (actin related protein 2 and 3), способного также создавать разветвлённую сеть актина и кэпировать его концы (Mullins et al., 1998; Hall et al., 2005). Стабилизация направленного движения клеток (хемотаксис) также контролируется Cdc42 (Etienne-Manneville and Hall, 2002). Белок Rac1 стимулирует образование ламеллоподий и раффлов (волнообразных выпячиваний цитоплазмы) (Heasman and Ridley, 2008). В случае активации Rac1 происходит преимущественная активация Arp2/3 комплекса, приводящая к формированию разветвлённой сети филаментного актина, которая и создаёт основу ламеллоподии (Hall et al., 2005) .

К подсемейству Rho-белков относятся три изоформы – RhoA, RhoB и RhoC, каждый из них способствует образованию стресс-фибрилл в клетке. Однако, между ними существуют некоторые отличия: например, белки RhoA и RhoC локализованы на плазмалемме, либо находятся в цитоплазме в секвестрированном GDIs состоянии. Белок RhoB же, локализуясь на эндосомах, регулирует эндоцитозный транспорт (Heasman and Ridley, 2008). RhoB функционирует как супрессор роста опухолей (Liu et al., 2001), а активация белка RhoС, напротив, увеличивает инвазивность раковых клеток (Hakem et al., 2005). Мыши, нокаутированные по генам rhoB и rhoC, жизнеспособны и не имеют заметных отклонений в развитии (Liu et al., 2001; Hakem et al., 2005). По генам RhoA, а также Cdc42 и Rac-белков получить нокаутированных мышей так и не удалось, поскольку такие животные летальны на ранних стадиях эмбриогенеза (Heasman and Ridley, 2008) .

Малые Rho-ГТФазы оказывают влияние не только на актиновый цитоскелет. Они также могут воздействовать на динамику микротрубочек за счет взаимодействия с плюс-концевыми белками, причём, как кажется, cdc42 и Rac1 положительно влияют на динамику микротрубочек, в то время как RhoA имеет противоположное действие (Grigoriev et al., 2006). Это особенно заметно во время миграции, когда происходит накопление стабилизированных микротрубочек, направленных в сторону движения клетки (Palazzao et al., 2001; Wen et al., 2004). Также происходит переориентация ЦОМТ: он занимает положение перед ядром по отношению к направлению миграции. Строго говоря, ЦОМТ, как правило, не меняет своего местоположения, в то время как ядро клетки смещается назад против направления движения клетки актинзависимым образом при участии Cdc42 (Gomes et al., 2005). Малые ГТФазы также оказывают влияние на промежуточные филаменты в клетке. Известно, что активация RhoA способствует разборке виментиновых филаментов, в то время как активные Rac1 и Cdc42 вызывают их перераспределение (Goto et al., 1998; Meriane et al., 2000) .

Малая ГТФаза RhoA 3.3.1 .

Малая ГТФаза RhoА была обнаружена в 1985 году как первый идентифицированный гомолог белка Ras. Данный белок высоко консервативен от дрожжей до млекопитающих и имеет молекулярный вес 21 кДа (Madaule and Axel, 1985) .

Белок RhoA является наиболее изученным представителем Rho-семейства. Его активность может регулироваться множеством способов, таких как контроль связывания и гидролиза нуклеотида за счет GEFs и GAPs, регуляция внутриклеточной локализации, изменение уровня экспрессии, фосфорилирование/дефосфорилирование, убиквитинилирование (Bustelo et al., 2007) .

Для RhoA известно множество GEF - это разнородная группа белков, положительно влияющих на его активность. К ним относятся GEF-H1, p115RhoGEF, Bcr (B-cell antigen

receptor) и многие другие белки (Rossman et al., 2005). Также многочисленны и GAP-белки:

p190Rho-GAP, myr5 (Myosin from rat 5), p50RhoGAP и другие: все они негативно влияют на активность RhoA, ускоряя гидролиз ГТФ в несколько тысяч раз (Narumiya, 1996; Zhang and Zheng, 1998). За последнее время к этой общепринятой схеме работы RhoA и прочих ГТФаз добавилось много деталей: так, например, синтез RhoA может находиться под контролем микроРНК, а ковалентные модификации изменяют активность малой ГТФазы и её внутриклеточную локализацию (Liu et al., 2012) .

К непосредственным эффекторам RhoA относятся фосфатидил-инозитол-5-киназа, серин/треониновые киназы, такие как PKN (protein kinase N) и p160ROCK (Narumiya, 1996) .

Также к её эффекторам относится белок mDia (mammalian homolog of Drosophila diaphanous), способствующий нуклеации актиновых филаментов и их сборке (Li and Higgs, 2003). Ещё один из эффекторов RhoA - одна из изоформ белка цитрон, обладающая киназной активностью и схожая с Rho-ассоциированной киназой (ROCK), но нечувствительная к её ингибитору Y27632 (Madaule et al., 1998). Момент фосфорилирования лёгких цепей миозина является ключевым в активации миозина и сборке стресс-фибрилл (Watanabe et al., 2007). Вероятно, p160ROCK и цитрон киназа играют наибольшую роль в этой активации, обе они фосфорилируют лёгкую цепь миозина по Thr18 и Ser19, что является одним из определяющих моментов для образования акто-миозинового сократительного кольца и последующего прохождения цитокинеза. Однако, киназа ROCK способствует более эффективной активации миозина, воздействуя также через активацию MLCK и инактивацию фосфатазы миозина (Riento and Ridley, 2003; Yamashiro et al., 2003). Во время же миграции клеток малая ГТФаза RhoA активируется на заднем крае клетки, воздействуя, в первую очередь, на киназу ROCK, которая вместе с MLCK участвует в сборке стресс-фибрилл, обеспечивающих сократительную силу для движения клетки (Riento and Ridley, 2003) .

Связь между RhoA и цитоскелетом является сложной и двунаправленной. Известно, что при разборке актиновых стресс-фибрилл цитохалазином D происходит активация RhoA;

интересно, что тот же эффект наблюдается при деполимеризации микротрубочек колхицином (Ren et al., 1999). Возможно, это связано с тем, что микротрубочки задействованы в регуляции активности малых ГТФаз Rho и Rac через фактор GEF-H1 (Krendel et al., 2002), который инактивируется при секвестрировании его лёгкой цепью связанного с Tctex-1 микротрубочками динеинового комплекса. Высвобождение GEF-H1 ведёт к активации RhoА и образованию актиновых стресс-фибрилл (Meiri et al., 2012). С другой стороны, RhoА может способствовать стабилизации микротрубочек через её эффектор mDia (Palazzao et al., 2001) .

Привлекаемый к плюс-концам Glu-микротрубочек белками EB1 и APC (adenomatous polyposis coli), mDia способствует накоплению стабильных микротрубочек на ведущем крае движущейся клетки (Wen et al., 2004). С другой стороны, избыточная активация RhoA опосредует чрезмерную стабилизацию микротрубочек, приводящую в итоге к нарушению их организации (Grigoriev et al., 2006) .

Очевидно, что регуляция активности малой ГТФазы RhoA представляет собой очень сложный процесс, в котором фигурирует множество участников. Отдельную группу представляют протеинкиназы, субстратом для которых является RhoA. Достаточно давно было установлено, что цАМФ- или цГМФ-зависимые киназы фосфорилируют белок RhoA по серину 188 (Lang et al., 1996; Sauzeau et al., 2000), что приводит к связыванию этого белка с GDI (guanine dissociation inhibitor) и препятствует встраиванию RhoA в мембрану клетки (Forget et al., 2002). Интересно, что такое ингибирование активности RhoA защищает этот белок от протеосомной деградации (Rolli-Derkinderen et al., 2005), которая может запускаться при убиквитинировании RhoA убиквитин-лигазой Smurf1 (SMAD specific E3 ubiquitin protein ligase 1), активирующейся на переднем крае клетки (Wang et al., 2003) .

Вероятно, сохранение временно инактивированной RhoA необходимо для её быстрого высвобождения и активации при определённых стимулах .

Рисунок 5. Возможный механизм регуляции киназой LOSK подвижности клеток .

На схеме показаны два сигнальных пути, регулируемые LOSK:

фосфорилирование р150Glued, приводящее к радиальной организации микротрубочек и фосфорилирование RhoA, приводящее к инактивации малой ГТФазы .

В 2008 году на примере гладкомышечных клеток сосудов было показано, что стимуляция рецептора AT2R («angiotensin II type 2 receptor») приводит к фосфорилированию RhoA по серину 188, причём данный процесс не зависел от активности цАМФ- или цГМФ-зависимых киназ. Оказалось, что в данном случае задействован следующий сигнальный каскад: вначале стимулированный рецептор активирует фосфатазу SHP-1 (Src homology 2 domain–containing protein-tyrosine phosphatase 1), которая дефосфорилирует казеинкиназу II (СК2), переводя её в неактивное состояние. Неактивная СК2 прекращает фосфорилировать LOSK, что приводит к активации последней. Активная LOSK фосфорилирует RhoA по серину 188, таким образом, способствуя связыванию с GDI в цитоплазме и ингибированию последующих реакций (Рисунок 5), приводящих, в конечном счёте, к сокращению сосудов. Результатом активации данного сигнального пути является расслабление гладкомышечных клеток сосудов (Guilluy et al., 2008) .

Интересно, что оверэкспрессия RhoA или её избыточная активность обнаруживаются в малигнизированных клетках рака груди, печени, кишечника и других органов (Orgaz et al., 2014), то есть фосфорилирование киназой LOSK RhoA, приводящее к инактивации последней, может снижать её онкогенные свойства .

Таким образом, LOSK способствует инактивации и запасанию неактивной RhoA в клетках. Это говорит о том, что данный механизм может быть задействован не только в регуляции мышечного сокращения, но также участвовать в цитокенезе и клеточной локомоции .

3.3.2. Клеточная подвижность и поляризация клеток

Направленное движение клеток – фундаментальный процесс, в основе которого лежат индуцируемые изменения внутриклеточной сигнализации, приводящие к масштабным изменениям системы цитоскелета и поляризации клетки в сторону действующего стимула. Этот процесс чрезвычайно важен для обеспечения заживления ран, индукции иммунного ответа, а также является основополагающим в процессе эмбрионального развития. Как снижение локомоторной активности, так и гиперподвижность клеток могут приводить к тяжелым патологиям, таким как, например, нарушения миграции клеток иммунной системы или же метастазирование опухолевых клеток, соответственно .

Одиночная движущаяся клетка, как правило, поляризована: в ней можно выделить передний (ведущий) и задний (отстающий) края клетки. При типе движения, характерном для мезенхимальных клеток, передний их край представлен в виде широкого выступа – ламеллоподии. Также одновременно с ламеллоподией могут сосуществовать многочисленные узкие выросты, филоподии. В зависимости от конкретных обстоятельств эти структуры могут воспринимать внешние сигналы, генерировать движущую силу для передвижения и поддерживать направление движения. В то же самое время на заднем краю клетки образуются акто-миозиновые пучки, или стресс-фибриллы, ответственные за подтягивание тела клетки (Vicente-Manzanares et al., 2005) .

Несмотря на разнообразие способных к движению типов клеток, молекулярные механизмы клеточной подвижности являются схожими, поскольку большинство из них консервативны в эволюции. При фибробластоподобном движении клеточная подвижность представляет собой цикл из четырех этапов: выдвижение переднего края, адгезия (прикрепление) к субстрату, подтягивание заднего края и деадгезия (открепление) (Pollard and Borisy, 2003). Интересно, что подвижность проявляется не только на уровне целых, неповрежденных клеток. Было показано, что фрагмент ламеллоподии кератоцита, лишенный ядра, центросомы, микротрубочек и большинства других органелл, также способен к направленному движению, что указывает на автономность ведущей ламеллоподии в этом процессе (Verkhovsky et al., 1999) .

При миграции клеток их прикрепление к субстрату обеспечивается фокальными контактами, которые представляют собой комплексы трансмембранных белков интегринов, связанных внутри клетки со стресс-фибриллами актина, а вне клетки – с компонентами внеклеточного матрикса, например, с белком фибронектином. Интегрины связаны с актином посредством цитоплазматических белков, таких как винкулин, паксиллин и зиксин. Контроль сборки фокальных контактов проходит при участии множества сигнальных молекул, таких как киназа фокальной адгезии (FAK - focal adhesion kinase), Src (от «sarcoma»), протеинкиназа С (PKC) и многих других посредников (Fogh et al., 2014) .

В передвижении клеток участвуют все структурные элементы цитоскелета, а основная роль в этом процессе принадлежит актиновым филаментам. Именно актиновый цитоскелет генерирует движущую силу для перемещения клетки. Малые ГТФазы семейства Rho, в частности Rac1, RhoA и Cdc42, регулируют движение, индуцируя образование определенного типа организации актина. В итоге, упрощённую схему клеточного движения можно представить следующим образом: на переднем краю клетки при активации Rac1 и Cdc42 запускается формирование ламеллоподии и выдвижение филоподий; на заднем крае клетки активируется RhoА, способствуя образованию стресс-фибрилл и стабилизации фокальных контактов, а также приводя к подтягиванию тела клетки (Рисунок 6) (Etienne-Manneville and Hall, 2002; Ridley et al., 2003) .

В действительности, позже было установлено, что активация RhoA также происходит и на переднем крае клетки. Оказалось, что Rac1, RhoA и Cdc42 могут регулировать активности друг друга: Cdc42 может активировать Rac1, а Rac1 и RhoA могут взаимно ингибировать друг друга .

Во время движения RhoA активируется на краю клетки синхронно с выдвижением ламеллоподии, в то время как Cdc42 и Rac1 активируются на расстоянии 2 мкм от края клетки с задержкой приблизительно в 40 секунд. Вероятно, это означает, что RhoA необходима для инициации формирования выступа на переднем крае, в то время как Rac1 и Cdc42 отвечают за его стабилизацию (Machacek et аl., 2009) .

Роль промежуточных филаментов в процессах клеточной подвижности изучена пока недостаточно, однако известно, что у мышей, нокаутированных по гену одного из белков промежуточных филаментов, виментину, нарушен процесс клеточной миграции, в частности, заживление ран (Eckes et al., 2000) .

Рисунок 6. Регуляция клеточной подвижности малыми ГТФазами семейства Rho (пояснение в тексте) .

Что же касается микротрубочек, долгое время их роль в миграции клеток оставалась невыясненной: клетки небольшого размера, например, кератоциты или лейкоциты не демонстрировали сниженную способность к миграции даже при полностью разобранных микротрубочках (Zigmond et al., 1981; Euteneuer and Schliwa, 1984). При разрушении же микротрубочек в фибробластах их способность к направленной миграции оказалась нарушенной (Vasiliev et al., 1970). Вероятно, во время клеточной миграции динамичные микротрубочки оказывают воздействие на полярность клеток и их подвижность за счет негативной регуляции активностей малых ГТФаз Rho и Rac, что способствует индукции поляризации клетки в направлении стимула и поддержании ею направленного движения (рисунок 6) (Meiri et al., 2012; Yoo et al., 2012) .

Как уже было отмечено, при миграции клетки ядро клетки смещается назад, приводя к переориентации ЦОМТ в сторону движения (Gomes et al., 2005). Как правило, вместе с этим происходит такое же переориентирование аппарата Гольджи, который, как известно, в некоторых случаях и сам может выступать как ЦОМТ. Расположение АГ на переднем крае клетки является хорошем критерием общей поляризации клетки и её способности направленно мигрировать. Механизмы поляризации ЦОМТ (центросомы) и АГ, тем не менее, отличаются: за ориентацию центросомы отвечает преимущественно система микротрубочек, в то время как ориентация АГ зависит от актинового цитоскелета. Несмотря на это, они тесно связаны друг с другом через малую ГТФазу RhoA: при ингибировании mDia нарушается поляризация АГ, но не центросомы, в то время как на фоне ингибирования p160ROCK нарушается поляризация как центросомы, так и АГ, что, однако, увеличивает скорость миграции клеток в последнем случае (Magdalena et al., 2003) .

Отсюда можно вывести, что RhoA (не обладающая избыточной активностью) выступает в качестве ограничителя клеточной подвижности, но в тоже время она отчасти способствует поляризации клетки, обеспечивая направленность клеточного движения. Так как киназа LOSK может способствовать переводу RhoA в неактивное состояние, она, вероятно, может увеличивать скорость миграции клеток. В то же время при нормальной активности LOSK клетки сохраняют направленность их движения (Roovers et al., 2009; Бураков и Надеждина, 2010). Вероятно, LOSK участвует также и в другом сигнальном пути, приводящем к поляризации клетки и способствующем поддержанию направленности её движения. В пользу этого свидетельствует тот факт, что именно 1A-изоформа белка p150Glued концентрируется на микротрубочках, направленных в направлении миграции клеток (Жаппарова, 2008; Zhapparova et al., 2009). Кроме того, имитирующий фосфорилирование p150Glued способен восстанавливать поляризацию аппарата Гольджи на переднем краю клетки, которая нарушается при ингибировании LOSK (Zhapparova et al., 2010). Таким образом, именно фосфорилирование p150Glued, регулирующее систему микротрубочек в клетках, может быть ключевым механизмом, определяющим клеточную поляризацию .

–  –  –

В работе были использованы: микроцентрифуга Mini Spin 5415 (Eppendorf), центифуга J2Beckman), ультрацентрифуга Optima TLX (Beckman), прибор для горизонтального электрофореза SE-2 (Хеликон), прибор для вертикального электрофореза VE-2 (Хеликон), прибор для жидкого переноса белков Mini Trans-Blot Cell (BioRad), УФ-трансиллюминатор ECX-15.M (Vilber Lourmat), автоматический ПЦР-амплификатор Mastercycler (Eppendorf), pHметр PB-11 (Sartorius), спектрофотометр U-2000 (Hitachi), электронные весы E 5500 S (Sartorius), магнитная мешалка R3T (MLW), термостат Termo 24-15 (Biokom), шейкеринкубатор Unimax1010 (Heidolph Instruments), ультразвуковой дезинтегратор Sonic Dismembrator 550 (Fischer Scientific), ламинарный шкаф TC 48 (Gelaire), автоклав PBI Autoclave Stematic III, СO2-инкубатор (Heraeus), кельвинатор Sanyo Ultra Low -85°C, холодильный шкаф (LKB), система для получения деионизированной воды (Millipore), автоматические дозаторы (Eppendorf) .

Инвертированный флуоресцентный микроскоп Carl Zeiss Axiovert 200M, снабженный цифровыми камерами AxioCamHR и AxioCamMR3 и программным обеспечением Axiovosion v .

4.6 (Zeiss), а также системой для контроля температуры и камерой для прижизненных наблюдений (PeCon GmbH) .

Расходные материалы 4.1.2 .

Предметные и покровные стекла (Menzel-Glaser), покровные стекла с горизонтальной и вертикальной разметкой (Bellco). Центрифужные пробирки объёмом 50 и 15 мл (Falcon), пробирки эппендорф на 2, 1,5, 0,5 мл и тонкостенные пробирки-эппендорф для проведения ПЦР на 0,5 и 0,2 мл (Scientific Specialties Inc.). Пипетки Пастера стерильные (ПанЭко), пипетки стерильные на 5, 10 и 25 мл (Greiner). Одноразовые наконечники для пипеток на 1000, 200 и 10 мкл (Omnitip). Пластиковые чашки Петри для культивирования клеток диаметром 10, 6 и 3 см, чашки Петри со стеклянным дном (CellStar), чашки Петри микробиологические диаметром 10 и 3,5 см (Ленмедполимер), пластиковые матрасы для культивирования клеток объёмом 50 мл (Greiner), стерильные скребки для клеток (Costar) .

Нитроцеллюлозная мембрана Trans-Blot (Bio-Rad, диаметр пор 0,45 мкм), одноразовые фильтры с диаметром пор 0,2 мкм (Sarstedt), диализные мешки (Serva), парафильм (American National Can) .

–  –  –

Основную часть работы проводили на клетках линии Vero, адгезионной культуры, полученной из эпителия почки зелёной мартышки (Cercopithecus aethiops), которая имеет фибробластоподобную морфологию. Клетки линии Vero – гиподиплоидны (анеуплоидны) – в большинстве клеток 58 хромосом (Sheets, 1964). Также в работе использовалась культура BSC-1, берущая своё начало, как и Vero - из эпителия почки зелёной мартышки. Клетки линии BSC-1 гипотетраплоидны – в большинстве клеток – от 114 до 117 хромосом (Hopps et al., 1963) .

Для проверки экспрессии ДНК-конструкций и синтеза соответствующих белков применяли культуру клеток HEK293 эмбриональной почки человека, ввиду того, что липосомная трансфекция эффективнее всего работает именно в этой клеточной линии. Данная линия была получена путём аденовирусной трансформации нормальной культуры эмбриональной почки человека (Graham et al., 1977) .

Для изучения формирования первичных ресничек использовали клетки REF – культуру крысиных эмбриональных фибробластов. Все клеточные линии были любезно предоставлены д .

б. н. А. В. Бураковым .

–  –  –

DMEM/F12 [Dulbecco’s Modified Eagle’s Medium с добавлением 50% F12] (ПанЭко), Lглутамин, эмбриональная телячья сыворотка, пенициллин/стрептомицин (ПанЭко); 1 kb DNA Ladder (Сибэнзим); DTT [dithiothreitol], HEPES [4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid], N,N’-метиленбисакриламид, Nonidet NP-40, PIPES [piperazine-N,N-bis(2-ethanesulfonic acid)] (AppliChem); PMSF [phenylmethylsulfonyl fluoride] (Serva); Tween 80 (Helicon); -32PATФ (10 Ci; FEI Research Center, Обнинск, Россия), агар, агароза (Biorad); акриламид, ампициллин, АТФ (Serva); безнуклеазная вода (Fermentas), белковый краситель Понсо S (Serva);

бромид этидия, бромфеноловый синий; буфер PBS (pH 7,4) в таблетках (Панэко); раствор версена (ПанЭко); глицерин (Panreac); глицин, глутатион, глютатион-агароза (Sigma):

дезоксихолат натрия; деионизованная вода mQ собственного изготовления; диметилсульфоксид [DMSO]; ДНКаза; додецилсульфат натрия (Serva); дрожжевой экстракт (Difco); изопропанол (Chemapol); ингибитор РНКаз RNAse out (Invitrogen); ингибитор протеаз (Roche); канамицин ксиленцианол, лизоцим, -меркаптоэтанол, метанол (Labscan); персульфат аммония (Serva); Lполилизин, полиэтиленгликоль 4000, порошок параформальдегида (Pancreas); протеин А– сефароза (Sigma); раствор Aqua Poly/Mount (Polysciences); реагент для трансфекции Mirus Bio TransIT-LT1 (Mirus); среда LB [Luria-Bertani] (Amresco); среда для трансфекции Opti-MEM® I Reduced Serum Media (Invitrogen); субстрат для фосфатазы BCIP/NBT (KLN); сульфат магния (Serva); сухое молоко (Nestle); тетраэтилметилендиамин (TEMED); раствор трипсина (ПанЭко);

триптон, трис (Helicon); тритон X-100 (Sigma); трихлоруксусная кислота, уксусная кислота, хлорид калия, хлорид кальция, хлорид магния (Merck); хлорид марганца (Реахим); хлорид натрия, ЭДТА (Pharmacia); этанол (Ферейн) .

Ферменты и ДНК-вектора 4.1.5 .

В работе были использованы ферменты для работы с ДНК фирмы «Fermentas»: смесь Pfu и Taq ДНК-полимераз (HFEM – High Fidelity Enzyme Mix), фрагмент Клёнова, Т4 ДНК-лигаза, щелочная фосфатаза кишечника теленка CIAP, полинуклеотидкиназа фага Т4, эндонуклеазы рестрикции EcoRI, SalI, BamHI, KpnI, SmaI, буферные растворы для них. Для молекулярного клонирования использовали вектора pEGFP-С1, pEGFP-С2, mCherry-C2, dsRed-Monomer-C1, pGEX-4T1 (Clontech) .

–  –  –

Наборы для выделения плазмидной ДНК EndoFree Plasmid Maxi Kit, Plasmid Midi Kit, QIAprep Spin Miniprep Kit, набор для выделения ДНК из агарозного геля QIAquick Gel Extraction Kit, набор для выделения тотальной РНК из клеток RNeasy Mini Kit (Qiagen), набор реагентов для амплификации ДНК GenePak PCR Core (Изоген), набор для сайт-направленного мутагенеза Change-IT Multiple Mutation Site Directed Mutagenesis Kit (Affymetrix) .

–  –  –

Среда LB: готовую среду в порошке разводили водой и автоклавировали 30 минут при 121о С. LB-агар: перед автоклавированием в среду LB добавляли агар до концентрации 3% .

После остывания к LB или LB-агару добавляли канамицин до концентрации 30 мкг/мл или ампициллин до концентрации 50 мкг/мл. Агар разливали в пластиковые 10 см чашки Петри .

Среда SOB: 20 г/л триптон, 5,5 г/л дрожжевой экстракт, 10 мМ хлорид натрия, 10 мМ хлорид калия, 10 мМ хлорид магния, 10 мМ сульфат магния. Смешивали все компоненты, кроме хлорида магния и сульфата магния. В автоклавированную среду добавляли стерильные растворы хлорида магния и сульфата магния .

Буфер ТВ (для получения компетентных клеток): 10 мМ PIPES (pH=6,8), 55 мМ хлорид марганца, 15 мМ хлорид кальция, 250 мМ хлорид калия. Смешивали все компоненты, кроме хлорида марганца, доводили рН до 6,7 при помощи 10М гидроксида калия. Затем добавляли хлорид марганца и стерилизовали фильтрацией через мембранный фильтр с диаметром пор 0,22 мкм .

Буфер ТАЕ (электродный буфер): 50 мМ Трис-ацетат (рН=8,0), 20 мМ ацетат натрия, 2 мМ ЭДТА .

6х буфер для нанесения проб ДНК на гель: 0,25% бромфеноловый синий, 0,25% ксиленцианол, 50% глицерин .

10x Трис-глициновый буфер: 250 мМ Трис, 900 мМ глицин, 1% SDS, pH=8,3 .

4х буфер для нанесения проб белков на полиакриламидный гель (4хSB): 200мМ Tрис-HCl (pH=6,8), 400мМ -меркаптоэтанол, 4% SDS, 0,01% бромфеноловый синий, 40% глицерин .

Буфер для окрашивания белков в полиакриламидном геле: 50 мл ледяной уксусной кислоты, 125 мг Кумасси G-250, 550 мл воды .

Буфер для влажного переноса белков: 25 мМ трис, 192 мМ глицин, 20% метанол/этанол .

Буфер TBS: 750 мМ хлорида натрия, 10 мМ Трис, pH=7,2-7,4 .

Буфер TBST (раствор для отмывки нитроцеллюлозной мембраны): 0,05% Tween на TBS .

Буфер PBS, pH=7,4: 1 таблетка на 100 мл дистиллированной воды. (Состав буфера: 137 мM NaCl, 2.7 мM KCl, 100 мM Na2HPO4, 2 мM KH2PO4) .

Буфер для киназной реакции in vitro: 50 mM HEPES, 10 mM MgCl2, 100 mM KCl, 0.5 mM PMSF, 1 mM DTT, pH=7,4 .

PHEM буфер (50 mM PIPES, 50 mM HEPES, 1 mM EDTA, 2 mM MgSO4, pH=7.0) .

Буфер для иммунопреципитации: PHEM с добавлением 0.5% Nonidet P-40, 0.5% Triton Xи 0.25% дезоксихолат натрия .

Буфер А для выделения белка из бактерий: 1 mМ DTT, 1 mM PMSF, ингибитор протеаз .

Буфер Б: буфер А, содержащий 1% Тритона Х-100 .

Буфер для элюции GST-слитого белка с глутатион-агарозы: 50 мМ Трис-НCl (pH=8,8), 20 мМ глутатион .

Синтетические олигонуклеотиды 4.1.8 .

Последовательности использованных в работе синтетических олигонуклеотидов (праймеров) приведены ниже. Использовали разные варианты олигонуклеотидов: для амплификации участка кДНК, содержащего открытую рамку считывания целевого белка, как правило, применяли пару относительно коротких (20-25 нуклеотидов) высокоспецифичных праймеров, подобранных в программе BLAST. Для последующего клонирования фрагментов ДНК в вектора использовали праймеры, комплементарные началу и концу кодирующей части фрагмента ДНК, содержащие дополнительные навески из нуклеотидов, создающие сайты узнавания определённых эндонуклеаз рестрикции. Для сайт-направленного мутагенеза применяли 35-50-нуклеотидные праймеры, рассчитанные по указаниям производителя набора реагентов для мутагенеза и содержащие внутри себя соответствующие нуклеотидные замены .

Также были использованы несколько праймеров для секвенирования ДНК. Все олигонуклеотиды были синтезированы в фирме «Синтол» .

Таблица 1. Олигонуклеотиды, использованные в работе .

название последовательность RhoA for aaagaattcATGGCTGCCATCCGG RhoA rev Amut aaagtcgacTCACAAGACAAGGCACCCAGCTTTTTTCTTC RhoA rev Emut aaagtcgacTCACAAGACAAGGCACCCCTCTTTTTTCTTC

RhoA G14V mut CTGGTGATTGTTGGTGATGTTGCCTGTGGAAAGACATGC

Kan rev TCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCG

p150 R148Wmut CCGAAAGACCACAACTTGGCGACCCAAGCCCACGC p150 R149Qmut AAAGACCACAACTCGGCAACCCAAGCCCACGCGCC

GRIP for TTCGAAGTCCGGGAGAAACC

название последовательность

GRIP rev AGGATCAGCTACCCCCTGAG

GRIP for BamHI aaaaggatccGCGCCTTCCGTCACGAATAACACTG GRIP rev BamHI aaaaggatccCTAGGACCATGGTATCCGAGGGTTTG GFP for Seq TCCTGCTGGAGTTCGTGACC pEGFP-C rev Seq GGGAGGTGTGGGAGG p150 Elon for aaagaattcATGGCACAGAGCAAGAGGCACGTGTACAGCCGGACG p150 T rev aaagtcgacGGCCCCAGCCACCCCAG

–  –  –

Для иммунофлуоресцентного окрашивания использовали вторичные козьи или ослиные антитела категории ML фирмы Jackson Immunoresearch с конечной концентрацией 15 мкг/мл:

- anti-mouse IgG, конъюгированные с FITC, TRITC, Cy5 .

- anti-rabbit IgG, конъюгированные с FITC, TRITC, Cy5 .

- anti-rat IgG, конъюгированные с FITC, Cy5, AMCA .

- anti-goat IgG, конъюгированные с TRITC .

В качестве вторичных антител для вестерн-блота применяли козьи антитела к иммуноглобулинам мыши или кролика, конъюгированные с щелочной фосфатазой (KLP) в разведении 1:2000 (конечная концентрация 0,5 мкг/мл) .

–  –  –

Клетки культивировали при одинаковых условиях либо на чашках Петри диаметром 10 см, либо на матрасах из культурального пластика. В СО2 инкубаторе для клеток поддерживалась температура 37С и 5% содержание углекислого газа. В качестве среды культивирования использовали DMEM/F12 (1:1) с 10% содержанием эмбриональной телячьей сыворотки, 2 мМ L-глутамина и смеси антибиотиков пенициллина и стрептомицина с итоговой концентрацией 10 мкг/мл. При дорастании клеток до монослоя проводили пассирование их 0,25 % раствором трипсина с разведением клеточной суспензии приблизительно в 10 раз .

Липосомная трансфекция клеток плазмидной ДНК 4.2.1.2 .

Клетки для трансфекции рассаживали либо на покровные стёкла в 3 см чашках Петри, либо на чашки для прижизненного наблюдения.

Трансфекцию проводили по следующей схеме:

- в эппендорф добавляли 250 мл чистой среды OptiMem,

- добавляли плазмиду в количестве 2,5 мкг,

- добавляли 7,5 мкл трансфектанта TransIT®-LT1 Transfection Reagent (Mirus),

- смесь инкубировали в течение 30 минут при комнатной температуре, после чего добавляли её по каплям в чашку с клетками .

На следующий день в зависимости от экспериментальной задачи проводили фиксацию с последующим иммуноцитохимическим окрашиванием либо прижизненную съёмку, либо приготовление образцов для электрофореза .

Химические воздействия на клетки 4.2.1.3 .

Для разборки микротрубочек в клетках в среду культивирования добавляли нокодазол (Sigma) до итоговой концентрации 1 мкг/мл. После 2-х часов инкубирования в среде с нокодазолом клетки отмывали в чистой среде необходимое для эксперимента время, после чего фиксировали и окрашивали антителами по стандартной схеме .

Для разборки стресс-фибрилл актина в среду добавляли цитохалазин B (Sigma) до конечной концентрации 5 мкг/мл на 2 часа .

Для разборки аппарата Гольджи в среду культивирования добавляли брефелдин А (Sigma) в концентрации 3 мкг/мл на 2 часа .

Ингибирование GSK-3: в среду культивирования добавляли ингибитор GSK-3 XI (Santa Cruz) до конечной концентрации 500 нМ на 1 сутки .

Для ингибирования Rho-ассоциированной киназы p160ROCK в среду культивирования добавляли Y27632 (Sigma) до конечной концентрации 10 мкМ перед прижизненным наблюдением клеток .

Фиксация клеток и иммуноцитохимическое окрашивание 4.2.1.4 .

Для иммуноцитохимического окрашивания клетки отмывали от среды культивирования в растворе PBS в течение нескольких секунд .

Стандартная процедура фиксации включала в себя фиксирование абсолютным метанолом при -20 С в течение 5-10 минут с дальнейшим переносом стёкол с клетками в 3% разведённый на PBS параформальдегид на 15 минут при +4 С .

В некоторых случаях применяли фиксацию 3% параформальдегидом при комнатной температуре в течение 20-ти минут, добавляя к нему Тритон-Х100 в последние 3 минуты фиксации до конечной его концентрации 0,1% .

Далее, в зависимости от задачи эксперимента, клетки либо заключали в заливочную среду на предметные стёкла, либо же переходили к процедуре иммуноцитохимического окрашивания .

Для непрямой иммунофлуоресценции фиксированные на стёклах клетки в течение часа последовательно инкубировали с первыми, а после, со вторыми антителами, разведёнными на PBS. Фиксатор или несвязавшиеся антитела отмывали в PBS 2 раза по 15 минут. Стёкла заключали в заливочную среду .

Анализ миграции клеток в рану монослоя 4.2.1.5 .

Для экспериментов по изучению параметров направленного движения клетки рассаживали в количестве не более 30% от монослоя в 30 мм пластиковые чашки Петри со стеклянным дном c 2 мл культуральной среды. На следующий день (при достижении 50-70% субконфлюэнтного монослоя) проводили трансфекцию клеток. Через 16-24 часа после трансфекции наносили экспериментальную рану монослоя (удаление части клеточного монослоя) посредством стерильного наконечника для автоматических пипеток и меняли культуральную среду на свежую, чтобы удалить повреждённые и мёртвые клетки. Наблюдение за клетками начинали через полчаса после нанесения раны. По флуоресценции GFP находили на краю экспериментальной раны трансфицированную клетку и начинали прижизненную цейтраферную видеосъёмку данного участка (рисунок 7). Фотосъемку движущихся клеток производили с интервалом в 10 мин в течение 4-10 часов, используя фазово-контрастный суховоздушный объектив 20x или иммерсионный объектив 63х .

Получение цитопластов 4.2.1.6 .

Клетки заранее высаживали на специальные подложки, представляющие собой пластмассовые кружки, соответствующие внутреннему диаметру эппендорфа, с приклеенными к ним покровными стёклами, покрытыми L-полилизином. Клетки трансфицировали, а на следующий день добавляли в среду культивирования цитохалазин B до 5 мкг/мл и нокодазол до 3мкг/мл на 2 часа. Затем кружки помещали клетками вниз в эппендорф с вышеописанной средой на твердое основание из части наконечника для пипетки на 1 мл. Клетки центрифугировали на скорости 5000-10000 rpm в предварительно прогретой до 37 °С центрифуге Microfuge 12 в течение 10-20 минут. Затем стёкла с клетками отделяли от пластмассовой основы, отмывали несколько раз в чистой среде культивирования и оставляли на несколько часов для восстановления. После цитопласты фиксировали и окрашивали антителами по стандартной схеме .

Иммунофлуоресцентная микроскопия и прижизненные наблюдения 4.2.1.7 .

клеток Наблюдение и фото-видеосъёмку клеток осуществляли при помощи фазово-контрастной и флуоресцентной микроскопии, используя инвертированный микроскоп Carl Zeiss Axiovert 200М, снабженный 12-битными цифровыми камерами AxioCam HR и AxioCam МR3, программным обеспечением AxioVision Rel. 4.6 и камерой для прижизненных наблюдений (Carl Zeiss, Германия). Для наблюдений использовали суховоздушный объектив Plan-Neofular 20х и иммерсионный объектив Plan-Apochromat 63x. В качестве источника освещения при флуоресцентной микроскопии использовалась ртутная лампа N HBO 100 мощностью 100 Ватт .

Для прижизненных наблюдений в чашку Петри с культивируемыми клетками наслаивали 2-3 мл вазелинового масла так, чтобы оно полностью покрывало среду. Это было необходимо для того, чтобы среда медленнее защелачивалась и клетки могли оставаться живыми продолжительное время. Перед наблюдением подготавливали камеру для прижизненных наблюдений: все наблюдения проводили при температуре 37С, столик микроскопа также был подогрет до 37С .

Также в работе применяли метод, совмещающий в себе прижизненное наблюдение клеток и иммунофлуоресцентную микроскопию. Перед экспериментом подготавливали чашки Петри с отверстием в дне, куда приклеивали вакуумной смазкой расчерченное на квадраты покровное стекло (Bellco). После проведения прижизненной съёмки было возможно сразу же зафиксировать и окрасить клетки антителами по стандартной схеме .

Обработка результатов 4.2.1.8 .

Обработку результатов, полученных с помощью видеомикроскопии, проводили при помощи программы ImageJ (v. 1.46). Для анализа подвижности клеток отмечали положение клеточного ядра на фотографиях, получаемых через каждые 10 мин прижизненного наблюдения. По полученным точкам строили траекторию движения клетки (трек). Для прорисовки треков использовали плагин Manual tracking в программе ImageJ (рисунок 7). Для статистической обработки полученных данных использовали программу Microsoft Excel .

Для количественной оценки клеточной подвижности вычисляли среднюю скорость движения клетки. Для этого расстояние, пройденное клеткой за все время фильма, делили на время наблюдения за клеткой .

Измерение направления движения проводили следующим образом. Считали общую длину трека как сумму перемещений клеток за каждые 10 минут фильма – r (route), а также длину вектора перемещения как расстояние между начальной и конечной точками – D (displacement) .

Затем находили отношение длины вектора перемещения к длине всего трека. Если данная величина приближалась к единице (то есть длина вектора приближалась к длине трека), то движение клетки считали более направленным (прямолинейным), по сравнению с клеткой, для которой эти величины различались сильнее и величина направленности была существенно меньше единицы .

Рисунок 7. Подсчёт скорости и направленности движения клеток в рану монослоя .

При цейтраферной видеосъёмке клеток, отмечали положение каждой клетки с интервалом 10 минут. Далее по окончанию съёмки определяли путь пройденный клеткой (D) и траекторию её движения (r). Направленность движения каждой клетки определяли как отношение D/r. Относительную скорость движения контрольных клеток определяли как отношение длины её траектории к средней длине траекторий двух соседних нетрансфицированных клеток, приведённое к общему времени наблюдения .

После проведения достаточного числа экспериментов находили средние значения скоростей движения клеток и их направленности. Результаты представляли в виде среднее значение ± стандартная ошибка (SE, от англ. «standart error of meaning») или же ± стандартное отклонение (SD, от англ. «standart deviation») .

Для оценки достоверности сравниваемых средних величин использовали t-критерий Стьюдента (двухвыборочный t-критерий для независимых выборок); различия между средними значениями считали достоверными при p0,05. На графиках p0,05 изображали одним символом «», p0,01 – двумя, p0,001 – тремя .

Фотографии и фильмы обрабатывали при помощи программ Adobe Photoshop CS2 и ImageJ (v. 1.46). Для отображения структур использовали различные псевдоцвета .

–  –  –

Некомпетентные бактерии E.coli рассевали на агаризованную среду LB, не содержащую антибиотика, и инкубировали 16 ч при 37°С, затем одну колонию переносили в 50 мл среды LB и растили бактерии при 23°С в течение 18-22 часов. После этого в суспензию клеток добавляли 150 мл среды SOB и доращивали бактерии при 27°С до ОD600=0,6. Далее клетки охлаждали во льду и осаждали при 5000 об/мин (JA-20, Beckman) 10 мин при +4°С. Осадок ресуспендировали в 16 мл буфера ТВ, инкубировали на льду 10 мин. После чего повторно центрифугировали бактерии 10 минут при +4°С и 3000 об/мин и ресуспендировали клетки в 4 мл ТВ. Добавляли DMSO до концентрации 7% и инкубировали на льду 10 мин. Аликвоты клеток замораживали в жидком азоте и хранили при -70°С .

Трансформация бактерий 4.2.2.2 .

Для получения необходимых количеств имеющейся плазмидной ДНК, отбора клонов содержащих полученную в процессе лигирования или же мутагенеза рекомбинантную плазмиду, а также нарабатывания рекомбинантных белков использовали трансформацию бактерий методом теплового шока. Компетентные клетки бактерий, хранящиеся при -70С, размораживали во льду. В эппендорфе смешивали 20 мкл компетентных клеток и 0,2 мкг плазмидной ДНК; при трансформации лигазной смесью объём последней составлял 10 мкл, объём компетентных клеток увеличивали до 100 мкл. Далее, смесь бактерий и ДНК инкубировали во льду в течение 20 минут, затем подвергали клетки тепловому воздействию при 42С в течение 90 секунд. После этого бактерии вновь переносили на лёд; через 2 минуты к ним добавляли 1 мл чистой бактериальной среды LB в эппендорф и инкубировали их 1 час при 37С. По истечению времени инкубации клетки осаждали на центрифуге Eppendorf MiniSpin при скорости 5000 rpm, супернатант сливали, а осадок распределяли шпателем Дригальского в чашке Петри по агару, содержащему селективный антибиотик. Чашку Петри переносили в термостат на 16-20 часов. На следующий день в чашке вырастали отдельные колонии бактерий, каждая из которых являлась клоном одной бактериальной клетки. Отдельную колонию подцепляли стерильной зубочисткой и помещали в колбу с 20 мл среды LB, содержащей селективный антибиотик. Колбу помещали на 12-15 часов в качалку, поддерживающую 37С и скорость 170 rpm. Спустя это время в колбе вырастали бактерии в достаточном количестве для выделения плазмидной ДНК набором QIAprep Spin Miniprep Kit. Для выделения плазмидной ДНК наборами EndoFree Plasmid Maxi Kit и Plasmid Midi Kit объём ночной культуры увеличивали согласно инструкции производителя Qiagen .

Синтез рекомбинантных белков в E. Coli 4.2.2.3 .

В первый день проводили трансформацию клеток E. Coli штамма BL-21 по вышеописанной методике. Затем отмечали на чашке 3-4 колонии и высаживали часть каждой из них в ночную культуру. На следующий день разводили бактерии из каждой колбы примерно в 30-40 раз и индуцировали синтез белка добавлением IPTG до конечной концентрации 0,4мМ на 4 часа при температуре 25С. После этого бактерии лизировали в 2-кратном SB, проводили электрофорез образцов и окрашивали гель путём нагревания его в растворе для окрашивания в микроволновой печи до кипения с последующей отмывкой в 10% уксусной кислоте. После отбиралась колония с наилучшей индукцией и высаживалась в 30 мл ночную культуру .

На следующей утро выросшие бактерии разводили в 1 литре LB, держали их 1 час при 37 С, после чего добавляли IPTG до 0,4 mM концентрации и оставляли их на 4 часа при 25 С и 170 rpm. Далее бактерии осаждали центрифугированием при скорости 6000 об/мин и +4С (ротор JA-14). Осадок перекладывали в пробирку на 50 мл и замораживали при -70С .

На следующий день приступали к выделению рекомбинантного белка из бактерий

–  –  –

РНК выделяли из клеток, доросших в 10 см чашке Петри до 60-70% монослоя, при помощи Rneasy Mini Kit (Qiagen) согласно инструкции производителя в стерильных условиях .

Дополнительно использовали -меркаптоэтанол (Helicon) и очищенный дополнительной перегонкой абсолютный этиловый спирт. Разрушение клеток проводили, пропуская их 5-6 раз через 2 мл стерильный шприц с иглой 21G .

Определение концентрации нуклеиновых кислот 4.2.3.2 .

Измерение концентрации нуклеиновых кислот проводили с помощью спектрофотометра HITACHI U-2000 при длине волны =260 нм. Предварительно, образцы разводили в 100 раз. 1 оптическая единица соответствовала концентрации ДНК в образце равной 0,05 мг/мл или концентрации РНК равной 0,04 мг/мл .

–  –  –

Для получения ПЦР-фрагментов, необходимых для последующего клонирования, реакцию проводили в 50 мкл смеси, содержащей 1x буфер для ДНК-полимеразы High-fidelity PCR Buffer c добавлением 1,5 мM MgCl2 (Fermentas), 200 мкМ каждого дезоксирибонуклеозидтрифосфата, по 20 пикомолей прямого и обратного праймеров, 1 нг плазмидной ДНК в качестве матричной и 2,5 единиц активности ДНК-полимеразы High-fidelity Enzyme Mix. Температуру отжига олигонуклеотидов рассчитывали с помощью программы «VECTOR NTI 9.0». Стандартная схема ПЦР включала в себя первичную денатурацию в течение 2-х минут при 94°С. В последующих 30-35 циклах денатурацию и отжиг олигонуклеотидов проводили в течение 30 секунд. Реакцию полимеризации проводили при 72°С, время элонгации подбирали из расчёта – 1 минута на 1 тысячу пар оснований. В последнем цикле финальная достройка ДНК осуществлялась при температуре элонгации в течение 1-5 минут, в зависимости от размера ПЦР-продукта

Сайт-направленный мутагенез 4.2.3.5 .

Мутагенез генетических конструкций осуществлялся при помощи набора Change-IT Multiple Mutation Site Directed Mutagenesis Kit. В основе метода лежит полимеразная цепная реакция с префосфорилированными на 5 -концах некомплементарными друг другу праймерами, один из которых содержит нуклеотидные замены. Для фосфорилирования 50-250 пкмоль 5концов олигонуклеотидов инкубировали 20 минут в буфере для полинуклеотидкиназы (PNK) в присутствии 1мМ АТФ и 10 единиц активности PNK. Фермент инактивировали нагреванием до 75 °С в течение 10 минут .

В ходе реакции ПЦР-мутагенеза синтезируются полностью 2 цепи плазмидной ДНК, что обуславливает длительное время элонгации: по 2 минуты на каждую тысячу пар оснований плюс ещё 5-10 минут на лигирование новосинтезированных цепей ДНК. По окончанию реакции в пробу добавляется ДНКаза DpnI на 3 часа при 37 °С для разрушения метилированной матрицы. Далее полученной смесью трансформировали бактерии DH-5 .

В некоторых случаях мутагенез проводили при помощи обычной реакции ПЦР, если мутацию было необходимо внести на краю амплифицируемого участка ДНК .

Результат сайт-направленного мутагенеза верифицировали секвенированием (ЦКП Геном, Институт молекулярной биологии имени В.А. Энгельгардта) .

Электрофорез ДНК в агарозном геле 4.2.3.6 .

Анализ фрагментов ДНК, полученных в ходе ПЦР, проводили в 1,2% агарозном геле, приготовленным на буфере 1хТАЕ и содержащем бромистый этидий (1мкг/мл), в горизонтальной камере при силе тока 30-40 мА. В препараты нуклеиновых кислот добавляли 6x буферный раствор для образцов (Fermentas) до однократной концентрации. В качестве электрофоретического буфера использовали 1хТAЕ. После электрофоретического разделения фрагменты ДНК визуализировали в проходящем ультрафиолетовом свете .

–  –  –

После электрофореза агарозный гель переносили на трансиллюминатор, где под ультрафиолетовым светом быстро вырезали фрагмент геля со светящейся полосой, соответствующей ПЦР-продукту необходимого размера. Выделение ДНК из геля проводили с помощью набора DNA Gel Extraction Kit (Fermentas) в соответствии с протоколом фирмы .

Дополнительно для выделения ДНК использовали изопропанол (Chemapol) .

Обработка ДНК эндонуклеазами рестрикции 4.2.3.8 .

Вектора или ПЦР-кассеты, обрабатывали соответствующими эндонуклеазами рестрикции .

Реакционная смесь объемом 20 мкл содержала 1-2 мкг ДНК, 1x буфер подходящий для рестриктаз (Tango, O или специфические буфера для EcoRI, BamHI), и по 5-10 ед .

соответствующих эндонуклеаз рестрикции. Смесь инкубировали 2-3 часа при 37°С .

Вектор, обработанный соответствующими эндонуклезами рестрикции, дополнительно обрабатывали щелочной фосфатазой для предотвращения самолигирования фрагментов ДНК .

Для этого к рестриктной смеси добавляли щелочную фосфатазу кишечника теленка (CIAP) из расчета 1-2 единица активности на 1 мкг ДНК и инкубировали в течение 20 минут при 37°С .

Фосфатазу инактивировали нагреванием до 75°С в течение 10 мин, затем ДНК очищали с помощью электрофореза в 1,2% агарозном геле .

Лигирование фрагментов ДНК 4.2.3.9 .

Фрагменты ДНК обработанные эндонуклеазами рестрикции, лигировали с соответствующими векторами, гидролизованными этими же ферментами. Реакцию проводили в 20 мкл смеси, содержащей 1х буфер для Т4-лигазы, 5 единиц активности Т4 ДНК-лигазы, а также вектор и вставку в молярном отношении 1:1 – 1:5. Для лигирования по тупым концам лигазная смесь дополнительно содержала 2 мкл 50% полиэтиленгликоля с молекулярной массой 4000 (Fermentas). Лигирование проводили при 22 °С в течение 1 ч, как правило, после этого лигазную смесь дополнительно оставляли на ночь при температуре 10°С. Фермент инактивировали нагреванием при 65°С в течение 20 мин. Полученной смесью трансформировали компетентные клетки E. coli штамма DH5 и высевали на соответствующую селективную среду .

Отбор клонов, содержащих рекомбинантные плазмиды, проводили с помощью набора GenePak PCR Core (Изоген), проводя ПЦР с отдельных колоний. Температурный режим и временные характеристики реакции выбирались аналогичным способом, как и в случае получения ПЦР-фрагментов. Отсутствие мутаций в клонированных генах подтверждали секвенированием, молекулярную массу синтезирующихся белков – Вестерн-блоттингом .

–  –  –

Все процедуры выполняли на льду или при 4 °С. Бактериальный осадок размораживали, добавляя к нему 20 мл ледяного буфера А. Добавляли 2 мл лизоцима (10мг/мл на mQ) и оставляли перемешиваться со скоростью 5-10 об/мин на полчаса. Затем добавляли 200 мкл 1M MgCl2, 200 мкл ДНКазы (10мг/мл на mQ) и 3 мл 10% Тритон Х-100 и снова оставляли на полчаса перемешиваться. После этого раствор подвергали воздействию ультразвука Sonic

Dismembrator 550 (Fischer Scientific) на максимальной мощности в течение 15 минут с режимом:

15 секунд озвучивания и 30 секунд - пауза. Полученный опалесцирующий раствор центрифугировали на скорости 15000 rpm (ротор JA-20) 30 минут при +4 С. Супернатант смешивали с заранее приготовленной глутатион-агарозой (промытой 2 раза по 10 минут PBS и 2 раза – буфером В) и оставляли на 1 час перемешиваться в ротационном миксере. После инкубации агарозу осаждали и промывали 3 раза буфером А и 3 раза буфером В. На 25 минут добавляли элюирующий буфер, после чего элюат переносили в диализный мешок и ставили диализ протии буфера для киназной реакции 3 раза по 1 часу. Диализованные белки замораживали в жидком азоте и хранили при -70°С .

Киназная реакция in vitro 4.2.4.2 .

Для киназной реакции брали:

- 5-10 мкг свежевыделенного GST-слитого каталитического домена киназы (GST-Ki),

- 15-25 мкг субстрата,

- 0,25мМ AТФ, или -32Ф-AТФ с активностью 10 Ci,

- буфер для киназной реакции – до 20 мкл .

Фосфорилирование просходило при комнатной температуре в течение 1 ч .

По окончанию фосфорилирования к пробам добавляли 10 мкл 4х SB. Далее образцы разделяли в полиакриламидном геле, переносили на нитроцеллюлозную мембрану и, в зависимости от использованного АТФ, проявляли окраской мембраны антителами против фосфотреонина, или же детектировали радиоактивную метку на приборе Phosphoimager .

Иммунопреципитация 4.2.4.3 .

Для иммунопреципитации клетки Hek293 трансфицировали за 1 день до эксперимента. На следующий день проверяли эффективность трансфекции. При наличии более 30% трансфицированных клеток их промывали холодным PBS, затем собирали и лизировали на льду в буфере PHEM с добавлением 0.5% Nonidet P-40, 0.5% Triton X-100, 0.25% дезоксихолата натрия и ингибиторов протеаз в течение получаса. После этого лизаты осветляли на ультрацентрифуге Optima TLX 20 минут при скорости 32000 rpm и температуре 4°C (ротор TLS55). После центрифугирования супернатант инкубировали с 5 мкг антител против GFP (Протеинсинтез) и 20 мкл 50% протеин A сефарозы 3 часа на льду. После инкубации сефарозу со связавшимися антителами и белком промывали 2 раза в буфере PHEM с детергентами и 2 раза без них. К сефарозе добавляли 20-30 мкл 2х SB и прогревали образцы 10 минут при 99 °C .

Затем образцы анализировали при помощи электрофореза с вестерн-блотом .

Приготовление клеточных гомогенатов для белкового электрофеза 4.2.4.4 .

Клеточную культуру, предварительно трансфицированную либо нет, выращивали в 30мм чашке Петри до состояния монослоя, после чего отбирали культуральную среду, далее клетки дважды промывали PBS, затем один раз дистиллированной водой. Добавляли 2х буфер SB в расчёте на диаметр чашки Петри и плотность культуры (30-40 мкл 2х SB на 30 мм чашку Петри с плотным монослоем клеток) и собирали клетки скрэппером. Полученный гомогенат инкубировали при 99°С 10 мин и хранили при -20°С. Перед нанесением на гель образцы прогревали при тех же условиях и центрифугировали в настольной центрифуге (1 мин, 13000 об/мин, «Eppendorf Mini-Spin») .

Белковый электрофорез в денатурирующих условиях 4.2.4.5 .

Электрофорез белков проводили в денатурирующих белки условиях (0,1% SDS) с модификациями в камере для вертикального электрофореза .

Гель толщиной 1 мм состоял из нижнего 10% разделяющего полиакриламидного геля (акриламид:N,N’-метиленбисакриламид в соотношении 30:0,8), содержащего 380 мМ Tris-HCl (pH=8,8), 0,1% SDS, 0,1% персульфата аммония, 0,1% TEMED; и верхнего 4% концентрирующего полиакриламидного геля (акриламид:N,N’-метиленбисакриламид в соотношении 30:0,8), содержащего 124 мМ Tris-HCl (pH=6,8), 0,1% SDS, 0,1% персульфата аммония, 0,1% TEMED. Высота концентрирующего геля была 20 мм, разделяющего – 50 мм .

В качестве маркеров использовали смесь 10-ти белков с молекулярными массами от 10 до 260 кДа (Bio-Rad). В качестве электродного буфера использовали 1x Трис-глициновый буфер. Электрофоретическое разделение белков проводили при следующих характеристиках электрического поля: в концентрирующем геле – сила тока 20 мА, в разделяющем геле – сила тока 40 мА при напряжении 215В .

–  –  –

Для окраски гелей их нагревали в микроволновой печи в растворе для окрашивания гелей до начала кипения. После остывания аналогичным образом отмывали несвязавшийся краситель в 10% уксусной кислоте .

–  –  –

Влажный перенос белков из полиакриламидного геля на нитроцеллюлозную мембрану осуществляли методом электропереноса в камере, заполненной холодным (+4°С) буфером для влажного переноса белков. Перенос осуществлялся при напряжении 99 V и силе тока 299 mA в течение 1-2 часов .

Для оценки содержания белка в каждом из образцов нитроцеллюлозную мембрану окрашивали красителем Понсо C, вырезали нужные фрагменты мембраны и затем их отмывали в буфере ТBST до полного исчезновения окраски .

–  –  –

Перед окрашиванием антителами производили инактивацию нитроцеллюлозной мембраны, инкубируя её в 5% растворе обезжиренного молока на TBST в течение ночи при +4°С. Для покраски мембраны антителами к фосфотреонину, её предварительно инактивировали в специальном растворе Membrane blocking solution (Zymed), не содержащем фосфорилированных пептидов .

Нитроцеллюлозную мембрану инкубировали 1 час с первичными антителами, разведенными в 5% растворе обезжиренного молока на TBST. Окрашивание целой мембраны или её частей проводили в ванночках из парафильма. На одну дорожку брали по 100-200 мкл раствора антител. Несвязавшиеся антитела отмывали буфером TBST (3 раза по 10 минут), затем инкубировали 1 час в растворе вторичных антител. Затем отмывали мембрану от антител 3 раза по 10 мин раствором ТBST и один раз TBS в течение 5 мин. Для проявки добавляли субстрат для фосфатазы (BCIP/NBT) и инкубировали при комнатной температуре до появления окраски .

После проявления мембрану отмывали дистиллированной водой и высушивали .

–  –  –

В ходе выполнения работы получены генетические конструкции, проверенные автоматическим секвенированием ДНК, а также электрофорезом и иммуноблотингом кодируемых белков (Таблица 4) .

Таблица 4. Генетические конструкции, полученные в работе .

–  –  –

Ранее был обнаружен сайт фосфорилирования 1А-изоформы белка p150Glued киназой LOSK (Жаппарова, 2008). Он представляет собой 3 идущих подряд остатка треонина (Thr145Рисунок 3г). Так как одновременное фосфорилирование соседних аминокислот представляет собой редкий феномен, мы решили проверить какие конкретные треонины могут быть фосфорилированы посредством LOSK. Для этого были выделены из бактерий и очищены аффинной хроматографией на глутатион-агарозе GST-слитые N-концевые участки p150Glued (1дикого типа и мутантные, содержащие замены треонинов на аланин (p150-1A(N), T145A, T146A, T147A, Т145-147А). Так же был выделен GST-слитый каталитический домен LOSK (1Далее проводили инкубацию 10 мкг препарата киназы с избытком субстрата (20-30 мкг) в присутствии -32P-ATФ. Затем к образцам добавляли 4х-кратный лизирующий буфер SB до однократной его концентрации, разделяли продукты реакции электрофорезом в денатурирующих условиях и переносили их на нитроцеллюлозную мембрану .

Включение фосфата с P детектировали с помощью прибора Phosphoimager. Оказалось, что при замене любого из треонинов в сайте фосфорилирования фосфат по-прежнему включался в белок, так же как и при реакции с p150-1A(N) дикого типа (Рисунок 8). Лишь полная замена всех 3-х треонинов приводила к прекращению фосфорилирования белка каталитическим доменом LOSK. Однако можно видеть, что 147-ой треонин, вероятно, является более значимым: интенсивность включения фосфата в p150-1A [T147A] была ниже, чем при использовании в качестве субстрата p150-1A дикого типа, а также рекомбинантных белков, содержащих T145A и T146A аминокислотные замены .

Рисунок 8. Фосфорилирование N-концов белка р150Glued каталитическим доменом LOSK .

Детекция радиоактивности включенного P, показывает, что фосфорилирование N-конца р150Glued происходит при любой одиночной замене треонина на аланин и прекращается лишь при полной замене всех трёх треонинов .

Мутации p150Glued в сайте узнавания LOSK, обнаруженные у 5.2.2 .

больных амиотрофическим склерозом, усиливают его фосфорилирование Мутации в гене динактина-1 часто обнаруживаются у больных нейродегенеративными заболеваниями, такими как латеральный амиотрофический склероз, синдром Перри и другими .

Недавно были обнаружены две мутации в p150Glued, располагающиеся возле сайта фосфорилирования киназой LOSK сразу после треонинов 145-147. Это замена 148-ого аргинина на триптофан и 149-ого аргинина на глутамин [R148W и R149Q] (Stockmann et al., 2013). Мы решили проверить, будут ли влиять эти аминокислотные замены на статус фосфорилирования белка. Для этого мы внесли соответствующие мутации в полноразмерный белок p150Glued и клонировали последовательности, кодирующие мутантные его N-концы (1-157) в вектор pGEXT1. Далее выделяли аффинной хроматографией GST-слитые белки и проводили киназную реакцию, как описано выше. Можно видеть, что антитела к фосфосерину/фосфотреонину хорошо узнают белок, инкубированный с каталитическим доменом киназы LOSK, АТФ и ингибиторами фосфатаз. При постановке реакции с p150Glued (1-157) R148W и R149Q оказалось, что мутации в этих положениях, особенно в 149-ом, усиливают включение фосфата в молекулу белка (Рисунок 9а). Таким образом, этот результат свидетельствует о некотором нарушении статуса фосфорилирования p150Glued при наличии таких мутаций в молекуле белка .

Рисунок 9. Мутации R148W и R149Q в белке р150Glued усиливают его фосфорилирование посредством LOSK .

(9а) Фосфорилирование N-концов белка р150Glued, содержащих аминокислотные замены R148W и R149Q каталитическим доменом LOSK. Детекция фсофорилированных N-концов р150Glued при помощи антител к фсофотреонину. (9б) Локализация полноразмерного GFP-слитого р150Glued [R149Q] в клетках Vero .

В то же время, мы решили проверить, как будет локализоваться полноразмерный p150Glued, несущий мутацию R149Q. Оказалось, что такой мутант при низком уровне экспрессии ведёт себя так же, как и нормальный белок p150Glued-1А, маркируя плюс-концы микротрубочек .

Отличие от экспрессированного p150Glued дикого типа заключалась в том, что большинство клеток содержали данный мутант на центросоме, в то время как центросомная локализация p150Glued-1А при его экспрессии наблюдается менее, чем у половины клеток (47±1,7%). При высоком же уровне экспрессии GFP-p150 [R149Q] связывался с микротрубочками по всей их длине (Рисунок 9б) .

–  –  –

В предыдущих исследованиях использовали генетические конструкции полноразмерного динактина-1 р150-3ТЕ и р150-3ТА. Было выяснено, что синтез в клетке р150-3ТА сам по себе нарушал систему микротрубочек в клетке, в то время как р150-3ТЕ оказывал менее выраженный негативный эффект. Более того, последний был способен восстанавливать организацию микротрубочек на фоне ингибирования LOSK (Жаппарова, 2008). Это различие могло быть опосредовано тем, что р150-3ТА и 3ТЕ могут по-разному взаимодействовать с компонентами динактинового комплекса. Несмотря на то, что участок связывания с ними (СС2) находится на значительном расстоянии от сайта фосфорилирования, изменение заряда белка p150Glued, вызываемое фосфорилированием, могло изменять его пространственную структуру, и влиять на сборку динактинового комплекса .

Для проверки этой гипотезы клетки HEK293 были трансфицированы генетическими конструкциями GFP-р150-3TA, GFP-р150-3TE и контрольным вектором pEGFP-C1. Белки из клеточного лизата были преципитированы при помощи антител к GFP, связанных с протеин А – сефарозой. Было обнаружено, что компоненты динактинового комплекса p50 и Arp1 p150Glued (Рисунок копреципитировались с обоими мутантами 10). Этот результат свидетельствует о том, что и р150-3ТА, и 3ТЕ образуют нормальный динактиновый комплекс, поэтому фосфорилирование p150Glued киназой LOSK, скорее всего, не влияет на сборку динактина .

–  –  –

Достаточно давно было установлено, что ингибирование активности LOSK приводит к серьёзному нарушению организации клеточных микротрубочек. При использовании ингибирующей активность LOSK генетической конструкции K63RT, как и при РНКинтерференции LOSK, наблюдается резкое снижение числа клеток, содержащих радиальную систему микротрубочек: с 85 до 20 процентов (Рисунок 11б). В данном случае систему микротрубочек оценивали только визуально (Burakov et al., 2008). Для наших исследований небходимо было также разработать объективные методы оценки системы микротрубочек .

Хорошим критерием степени хаотичности системы микротрубочек является подсчёт числа пересечений микротрубочек внутри участка клетки определённой площади (Рисунок 11а, 11г) .

При радиальной организации микротрубочек в клетках число их пересечений невелико, а при хаотической организации количество пересекающихся между собой микротрубочек резко возрастает. Такое увеличение числа пересечений микротрубочек, так же как и резкое возрастание числа клеток с хаотичными микротрубочками мы наблюдали при ингибировании LOSK и при ингибировании активности динеина, например, экспрессией СС1 домена p150Glued (Рисунок 11в). Так как LOSK непосредственно влияет на один из компонентов динактинового комплекса, её ингибирование может затрагивать моторные функции динеина в клетке, приводя ковенным образом к нарушению организации микротрубочек в клетках .

–  –  –

клетках, экспрессирующих СС1-домен белка p150Glued, ингибирующий активность динеина. (11г) Оценка состояния системы микротрубочек в контрольных клетках и в клетках с заингибированной LOSK при помощи подсчёта числа пересечений микротрубочек в отдельно взятой области внутри клетки (среднее±SD) .

Для проверки этой гипотезы мы экспрессировали в клетках GFP-слитый белок ERGIC53/LMANI, маркирующий стабильный цис-Гольджи и динамичные везикулы ERGIC, рециклирующие между ЭПР и АГ. Во флуоресцентном микроскопе снимали короткие видеофильмы по 40-90 кадров с интервалом в 1 секунду. Практически все везикулы, содержащие GFP-ERGIC, оказались подвижны: каждая из них как-то меняла своё местоположение за 1 секунду. При помощи плагина Manual Tracking в программе ImageJ мы следили за изменением положения каждой из видимых везикул за 1 секунду, а далее анализировали скорости движения (Рисунок 12а). Средняя скорость движения везикул составила 0,4 мкм/с. При построении гистограммы распределения везикул по скоростям оказалось, что большая часть везикул совершает беспорядочные диффузные движения со скоростью, не превышающей 0,5 мкм/с, в то время как меньшая часть двигается со скоростью 0,5 мкм/с и быстрее, что соответствует процессивному динеин-зависимому транспорту (Рисунок 12б) .

Для того, чтобы убедиться в этом, мы коэкспрессировали в клетках GFP- ERGIC53 и СС1dsRed, а также измерили скорости движения везикул. Оказалось, что в этом случае средняя скорость движения везикул падала более чем в 2 раза, и это падение коррелировало с исчезновением второго пика на гистограмме распределения по скоростям, т.е. отсутствовали быстро движущиеся везикулы (Рисунок 12б, 12в). Этот результат свидетельствует о том, что движение везикул ERGIC обусловлено двумя составляющими – диффузионной и динеинзависимой .

Наконец, мы провели коэкспрессию GFP- ERGIC53 и K63RT-dsRed и измерили скорости движения ERGIC53-содержащих везикул таким же образом. Характер распределения везикул по скоростям их движения не претерпел никаких изменений, и средняя скорость их движения не отличалась от контрольных клеток (Рисунок 12б, 12в). Таким образом, активность динеиндинактинового комплекса не подлежит регуляции киназой LOSK, а значит, нарушение организации микротрубочек на фоне ингибирования LOSK вызывается не ингибированием динеина, а иными механизмами .

Рисунок 12. Ингибирование LOSK не влияет на активность динеинового транспорта в клетках. (12а) Подсчёт скорости движения ERGIC-53 содержащих везикул в клетках Vero при помощи программы ImageJ (объяснение в тексте). (12б) Распределение по скоростям везикул в контрольных клетках, клетках экспрессирующих LOSK-K63RT и СС1-фрагмент p150Glued. (12в) Средние скорости движения ERGIC-53 содержащих везикул .

–  –  –

Итак, оказалось, что активность LOSK не влияет на моторные функции динеина. Однако, для осуществления эффективного транспорта внутриклеточных компонентов необходимо наличие упорядоченной системы микротрубочек. Мы решили проверить, повлияет ли ингибирование активности LOSK с последующей дезорганизацией микротрубочек на внутриклеточный транспорт на большие расстояния .

Для этого в клетках экспрессировали GFP-ERGIC53. При добавлении в среду культивирования Брефелдина А (БФА), приводящему к слиянию АГ с ЭПР, в клетке оставалось множество тубуло-везикулярных структур, содержащих маркёры раннего везикулярного транспорта, в том числе и ERGIC53/LMANI. При отмывке от БФА начинался активный транспорт везикулярных компонентов к центру клетки с последующим их слиянием и формированием АГ. После 2-х часов восстановления, как правило, более чем в 60% клеток можно было наблюдать полностью или практически полностью сформированный АГ (Рисунок 13). В случае ингибирования LOSK такое восстановления АГ было более медленным: около 40% клеток демонстрировали собранный АГ, в то время как у большей части клеток он был лишь отчасти собран или же полностью диспергирован. Таким образом, активность LOSK способствует эффективному внутриклеточному транспорту, особенно транспорту на большие расстояния, вероятно, через поддержание упорядоченной системы микротрубочек .

Рисунок 13. Ингибирование LOSK нарушает сборку аппарата Гольджи после отмывки Брефелдина A. Показаны различные паттерны сборки АГ в клетках Vero и частота их встречаемости в норме и при ингибировании LOSK (среднее±SD) .

–  –  –

В работе А. В. Буракова с коллегами было показано, что экспрессия доминантнонегативной LOSK или её нокдаун приводят к нарушениям центросомной локализации компонентов динактинового комплекса, таких как динамитин и p150Glued. В то же время происходило нарушение организации микротрубочек в клетках (Burakov et al., 2008). Учитывая то, что локализованный на центросоме динактин необходим для удержания на ней микротрубочек (Quintyne et al., 1999) именно эффект ухода нефосфорилированного динактина с центросомы при ингибировании активности мог опосредовать хаотизацию LOSK микротрубочек в клетке. Это также подтверждалось тем фактом, что нефосфорилируемый по сайту узнавания LOSK p150Glued сам по себе значительно нарушал организацию микротрубочек в клетке, в то время как имитирующий фосфорилирование не оказывал такого эффекта и сам мог восстанавливать организацию микротрубочек в клетках с заингибированной LOSK (Жаппарова, 2008). Кроме того, как мы показали, мутант p150Glued [R149Q], который фосфорилировался посредством LOSK сильнее, чем белок дикого типа, имел высокое сродство к центросоме .

Мы оценили локализацию p150Glued, содержащего мутации в сайте фосфорилирования LOSK. Оказалось, что нефосфорилируемый конструкт был локализован на центросоме менее, чем в 40% клеток, в то время как имитирующий фосфорилирование – более чем в 60% (Рисунок 14). Причём, ингибирование LOSK не оказывало эффекта на содержание каждого из этих мутированных p150Glued на центросоме. Кроме того, локализация мутантов p150Glued, содержащих только 2 замены треонинов на аланин или глутаминовую кислоту (Т145-146А и Т145-146Е соответственно) повторяла таковую для белков с тремя аминокислотными заменами .

Однако двойной аланиновый мутант p150Glued был локализован на центросоме в большем числе клеток, чем 3ТА-мутант; то есть, предположительно, при наличии одного лишь треонина LOSK способна фосфорилировать p150Glued в этом сайте, что повышает сродство этого белка к p150Glued центросоме. Этот результат свидетельствует о том, что фосфорилирование протеинкиназой LOSK определяет его центросомную локализацию, и именно этот механизм задействован в регуляции образования радиальной системы микротрубочек в клетках. Причем, основополагающую роль здесь играет заряд, обеспечиваемый наличием фосфатов на треонинах 145-147, чем он выше – тем более вероятна центросомная локализация p150Glued .

Рисунок 14. Нефосфорилируемый и имитирующий фосфорилирование мутанты p150Glued имеют различное сродство к центросоме. (14а) Локализация GFP-слитых p150-3TA и 3TE в клетках Vero. (14б) Подсчёт числа клеток, в которых различные мутанты p150Glued локализованы на центросоме (среднее±SD) .

5.4. Регуляция центросомной локализации PCM-1 посредством LOSK

–  –  –

Экспрессия доминантной-негативной LOSK оказывает сильный эффект на систему микротрубочек. С одной стороны, организация микротрубочек зависит от наличия на центросоме определённых белков, таких как динактин или найнеин. С другой стороны, хаотизация микротрубочек может нарушать доставку необходимых для их же заякоривания белков на центросому. Один из таких белков – РСМ-1, который участвует в организации микротрубочек и образовании первичных ресничек в клетках; комплексы, содержащие этот белок, транспортируются на центросому по системе микротрубочек. В норме РСМ-1 локализуется на центросоме в 90% клеток Vero в виде яркой точки или плотного облака (Рисунок 15, 16). Синтез же LOSK-K63RT в клетках приводит к тому, что менее половины клеток показывают такие паттерны локализации РСМ-1 – он распределяется на большой площади диффузно вокруг центросомы или даже по всей клетке (Рисунок 16). Каков же возможный механизм влияния LOSK на локализацию PCM1?

Рисунок 15. В клетках Vero белок PCM-1 имеет центросомную локализацию в большинстве клеток. Визуализация локализации PCM-1 и p150Glued при помощи иммунофлуоресцентного окрашивания клеток .

Рисунок 16. Ингибирование LOSK приводит к нарушению центросомной локализации белка РСМ-1. Белок PCM-1 визуализирован в клетках Vero при помощи иммунофлуоресцентного окрашивания. Экспрессия доминантно-негативной LOSK приводит к резкому снижению числа клеток, содержащих PCM-1 на центросоме (среднее±SD) .

Как известно, РСМ-1 транспортируется на центросому в составе центросомных сателлитов - для осуществления этого процесса необходима активность динеина, динактиновый комплекс, связывающий его с PCM-1 и радиальная система микротрубочек. Учитывая, что ингибирование LOSK не оказывает влияния на активность динеина, уход РСМ-1 с центросомы на фоне экспрессии LOSK-K63RT, таким образом, может быть объяснён нарушением системы микротрубочек или локализации p150Glued в клетке .

Нарушение естественной локализации p150Glued в клетках 5.4.2 .

ведёт к истощению центросомного пула PCM-1 Мы решили проверить связано ли центросомное расположение PCM-1 с локализацией p150Glued, поскольку последний, являясь одним из основных субстратов LOSK, локализован на центросоме за счёт активности этой киназы. Мы создали генетическую конструкцию, кодирующую GFP-слитый полноразмерный белок p150Glued, на С-конце которого были добавлены 90 аминокислот, соответствующие GRIP-домену белка Гольджин 97. Такое добавление GRIP-домена приводит к тому, что белок начинает локализоваться на мембранах аппарата Гольджи, теряя своё естественное местоположение (Рисунок 17б). Как можно видеть на рисунке 17б, химерный белок GFP-p150-GRIP локализован на АГ, причём это приводит к тому, что другой компонент динактинового комплекса – белок р50 также может терять свою центросомную локализацию и перераспределяться на мембраны АГ (Рисунок 18б). Это свидетельствует в пользу того, что весь динактиновый комплекс при экспрессии GFP-p150GRIP может быть локализован на АГ. Локализация PCM-1 в таких условиях оказалась полностью нарушенной: мы не смогли обнаружить ни одной клетки с центросомной локализацией этого белка. Однако, PCM-1 перераспределялся по всему объёму клетки, не показывая никаких признаков солокализации с АГ и с GFP-p150-GRIP (Рисунок 18в). Повидимому, p150Glued непосредственно не принимает участия в удержании PCM-1 на центросоме:

основная его роль заключается в обеспечении транспорта этого белка путём образования упорядоченной системы микротрубочек. Либо же во взаимодействии этих двух белков должен участвовать С-конец белка p150Glued, который оказался экранированым в результате добавления GRIP-домена .

Рисунок 17. Локализация в клетках Vero химерных белков PACT-GFP-p150 и (17а) локализован на центросоме клеток GFP-p150-GRIP. PACT-GFP-p150 (центросома визуализирована при помощи антител к -тубулину). (17б) GFP-p150GRIP расположен в транс-Гольджи (визуализирован при помощи экспрессии генетической конструкции RFP-Golgi) .

Однако, похожий эффект мы наблюдали при экспрессии GFP-p150Glued, слитого на Nконце с PACT-доменом белка AKAP450, обеспечивающего его центросомную локализацию (Рисунок 17а). Несмотря на то, что рекомбинантный белок РАСТ-GFP-p150 всегда имел центросомное расположение и свободный С-конец, в большинстве случаев PCM-1 также находился в диспергированном по цитоплазме клетки состоянии (PCM-1 имел нормальную локализацию в 28,7±12,5% клеток) (Рисунок 19б). Таким образом, одного лишь p150Glued даже в составе динактинового комплекса недостаточно для удержания PCM-1 на центросоме. Такое драматическое снижение PCM-1 на центросоме может объясняться, во-первых, нарушением работы динеина, во-вторых, нарушением организации микротрубочек .

–  –  –

Известно, что экспрессия полноразмерного белка p150Glued ингибирует динеиновый транспорт в клетке. Такой подход зачастую используется вместо экспрессии СС1 (Kodani et al., 2010). Чтобы оценить степень ингибирования динеина, мы коэкспрессировали в клетках p150TA или p150-3TE совместно с GFP-ERGIC53. При различных уровнях экспрессии мы наблюдали, во-первых, в той или иной степени разрушенный АГ, во-вторых, остановку движения ERGIC53-содержащих везикул, которые демонстрировали лишь диффузные движения в цитоплазме клетки (Рисунок 20 б, в). Суммируя полученные результаты, можно заключить, что наблюдаемый уход РСМ-1 с центросомы при экспрессии РАСТ-GFP-p150 происходит за счёт частичного ингибировании активности динеина при внесении избытка p150Glued в клетку (при полном ингибировании динеина, достигаемом экспрессией СС-1, количество клеток, обладающих нормальной локализацией белка РСМ-1 снижается до 9,8±1,2%). Дополнительное же изменение его локализации, путём таргетирования на АГ генетической конструкции GFP-p150-GRIP, приводит к окончательной потере белком РСМ-1 его местоположения .

Рисунок 20. Экспрессия полноразмерного p150Glued нарушает динеиновый транспорт. Анализ движения ERGIC53-содержащих везикул в программе ImageJ .

(20а) в контрольных клетках (20б, в), в клетках, экспрессирующих p150-3TA и 3TE соответственно .

–  –  –

Так как эффективный транспорт белков на центросому обеспечивается не только динеиновым транспортом, но и системой микротрубочек, мы решили проверить, не является ли нарушение доставки PCM-1 на центросому на фоне ингибирования LOSK следствием одной лишь хаотизации микротрубочек. Поскольку экспрессия СС1 в данном случае не могла дать однозначный ответ ввиду ингибирования динеинового транспорта, мы использовали подход, связанный с ингибированием киназы GSK-3. Для этого в среду культивирования добавляли ингибитор GSK-3 в концентрации 500 нМ на сутки. Такое воздействие не ингибирует активность динеина и даже в некоторых случаях может её увеличивать (Gao, 2014). После инкубации клетки фиксировали и окрашивали антителами к PCM-1 и тубулину. При таком воздействии в большей части клеток была нарушена система микротрубочек (Рисунок 21а). Мы оценили локализацию PCM-1 только в клетках с полностью нарушенной радиальной системой микротрубочек. Оказалось, что содержание PCM-1 на центросоме приблизилось к таковому, наблюдаемому при ингибировании LOSK (Рисунок 21б). Учитывая то, что ингибирование LOSK не приводит к нарушению динеинового транспорта, можно заключить, что нарушение центросомной локализации PCM-1 связано исключительно с дезорганизацией системы микротрубочек .

Рисунок 21. Хаотизация микротрубочек, вызываемая ингибированием киназы GSK-3, приводит к нарушению центросомной локализации PCM-1 .

(20а) Визуализация микротрубочек и PCM-1 при помощи иммунофлуоресценции в клетках Vero, инкубированных в среде с 500 нМ ингибитора GSK-3 в течение суток .

(20б) Подсчёт числа клеток с хаотичными микротрубочками, содержащими PCM-1 на центросоме (среднее±SD) .

Ингибирование LOSK, сопровождаемое потерей центросомной 5.4.4 .

локализации белком PCM-1, не приводит к значительным нарушениям формирования первичных ресничек в клетках В клетках культуры крысиных эмбриональных фибробластов – REF, белок PCM-1 локализован так же, как и в клетках Vero: около 80% клеток демонстрируют расположение PCM-1 в виде яркого облака вокруг центросомы. Протеинкиназа LOSK также принимает участие в локализации этого белка: лишь 40% клеток с заингибированной LOSK содержат PCM-1 на центросоме (Рисунок 22а). Поскольку одна из функций центросомного PCM-1 заключается в формировании первичных ресничек, мы решили проверить, будет ли влиять ингибирование активности LOSK на образование первичных ресничек .

Клетки REF являются удобной моделью, для изучения этого процесса, так как они способны во время прохождения по клеточному циклу образовывать первичные реснички. Была проведена трансфекция клеток LOSK-K63RT с последующей фиксацией и окраской на ацетилированный тубулин, являющийся характерным маркёром первичных ресничек .

Оказалось, что около 56% контрольных клеток содержат ресничку, ингибирование LOSK снижает это число всего лишь до 49% (Рисунок 22б). Хотя в каждом из пяти проведённых экспериментов число опытных клеток, содержащих реснички, было немного ниже, разница с контрольными клетками была недостоверной при уровне значимости р=0,05. Проведя окраску на PCM-1 и ацетилированный тубулин в клетках, экспрессирующих LOSK-K63RT, мы обнаружили, что, несмотря на кажущееся исчезновение центросомной локализации PCM-1, небольшое его количество, как правило, оставалось в основании первичной реснички .

Вероятно, хаотизация системы микротрубочек, вызываемая экспрессией LOSK-K63RT, хотя и нарушает доставку PCM-1 на центросому, небольшое его количество, достаточное для образования первичных ресничек в клетках, всегда остаётся в связанном с центросомой состоянии. В то же время оказалось, что при ингибировании активности LOSK приблизительно четверть клеток демонстрировали полное перераспределение белка PCM-1 в цитоплазму. В этом случае мы наблюдали формирование первичных ресничек лишь в 9,8±1,2 процентах клеток. Этот результат свидетельствует о том, что LOSK всё-таки принимает некоторое участие в регуляции образования первичных ресничек в клетках посредством поддержания локализации белка PCM-1 .

Рисунок 22. Ингибирование LOSK приводит к нарушению центросомной локализации белка РСМ-1 в клетках REF и незначительным нарушениям формирования первичных ресничек. (22а) Белок PCM-1 визуализирован в клетках REF при помощи иммунофлуоресцентного окрашивания. Экспрессия доминантнонегативной LOSK приводит к резкому снижению числа клеток, содержащих PCM-1 на центросоме (среднее±SD). (22б) В клетке экспрессирующей LOSK-K63RT визуализирован белок PCM-1 при помощи иммунофлуоресценции. Первичная ресничка в клетках визуализирована при помощи антител к ацетилированному тубулину. Подсчёт числа клеток, содержащих первичную ресничку в контрольных клетках и при ингибировании LOSK (среднее±SE) .

–  –  –

Клетки Vero, используемые в работе, не способны эффективно организовывать микротрубочки на АГ. Во-первых, при нарушении работы центросомы система микротрубочек нарушается в большинстве клеток (Burakov et al., 2008). Во-вторых, в опытах по восстановлению микротрубочек (Рисунок 23 а-б) или наблюдению за EB1-GFP «кометами»

(Рисунок 23 в-г) заметна преимущественная центросомная нуклеация микротрубочек. В третьих, при иммуноцитохимическом окрашивании АГ в отличие от центросомы довольно редко локализуется в зоне схождения микротрубочек (данные не показаны). При получении из клеток Vero цитопластов, содержащих центросому, в большей их части микротрубочки образуют радиальную систему с центросомой в центре, в отсутствие центросомы в цитопластах микротрубочки в них полностью хаотизируются (Бродский, 2009) .

Мы решили изучить особенности организации микротрубочек в родственной Vero линии клеток BS-C-1. Оказалось, что в этих клетках АГ чаще всего локализован в зоне схождения микротрубочек, кроме того, встречаются клетки, в которых центросома лежит отдельно от ЦОМТ, представленного АГ. Также, часто встречались клетки с двумя независимыми ЦОМТ на АГ и на центросоме. Изучив особенности нуклеации микротрубочек, мы обнаружили значительную внецентросомную нуклеацию на мембранах АГ: после разборки микротрубочек нокодазолом множество микротрубочек росло от везикул диспергированного АГ (Рисунок 23 аб), кроме того EB1-GFP «кометы» часто вылетали из больших зон, вероятно, соответствующим АГ (Рисунок 23 в-г). Наконец, цитопласты, полученные из этих клеток вне зависимости от наличия центросомы организовывали радиальную систему с большой зоной схождения, в центре которой располагался АГ (Рисунок 25). Таким образом, клетки BS-C-1 представляют собой хорошую модель для изучения организации микротрубочек на АГ .

Рисунок 23. В клетках BS-C-1 аппарат Гольджи принимает участие в организации микротрубочек. (23а) Нуклеация микротрубочек на везикулах АГ клеток BS-C-1 после отмывки клеток от нокодазола (объяснение в тексте) .

Визуализация микротрубочек и АГ при помощи иммунофлуоресценции. (23б) Подсчёт числа связанных с АГ микротрубочек, нуклеированных на везикулах АГ после отмывки от нокодазола клеток Vero и BS-C-1. (23в) Прижизненное наблюдение за нуклеацией микротрубочек в клетках Vero и BS-C-1 при экспрессии GFP-слитого белка EB1. Визуализация АГ и центросомы в этих же клетках при помощи иммуновлуоресценции. (23г) Подсчёт числа микротрубочек нуклеируемых за одну минуту на центросомах и АГ клеток Vero и BS-C-1 .

В клетках, использующих аппарат Гольджи в качестве ЦОМТ, 5.5.2 .

активность LOSK незначительно влияет на организацию микротрубочек Далее мы решили оценить систему микротрубочек в контрольных клетках BS-C-1 и при ингибировании LOSK. Оказалось, что систему микротрубочек в клетках BS-C-1 можно назвать «радиальной» с большим преувеличением: после проведении рутинного разделения клеток с «радиальными» микротрубочками и «хаотичными» к первым можно было отнести около 40% клеток (Рисунок 24) .

–  –  –

экспрессирующих LOSK-K63RT. Микротрубочки и АГ визуализированы при помощи иммунофлуоресценции. На нижней картинке показано изменение числа клеток, с радиальными и хаотичными микротрубочками в контроле и при экспрессии LOSKK63RT в линиях Vero и BS-C-1 (объяснение в тексте) .

Около 30% клеток содержали неорганизованную систему микротрубочек и такое же количество обладало неопределённой организацией. В таком случае ингибирование LOSK имело очень незначительный эффект: количество клеток с абсолютно радиальной системой микротрубочек снижалось до 20%, а число клеток с полностью хаотизированными микротрубочками возрастало до 40%. Таким образом, общая картина организации микротрубочек в клетках BS-C-1 не претерпевала значительных изменений на фоне ингибирования LOSK по сравнению с клетками Vero .

Наконец, мы получили цитопласты из клеток BS-C-1, экспрессирующих LOSK-K63RT .

Как можно видеть цитопласты, полученные из этих клеток, также как и обычные цитопласты BS-C-1, обладают упорядоченной системой микротрубочек, имеющих широкую зону схождения в области нахождения аппарата Гольджи (Рисунок 25) .

–  –  –

5.6. Регуляция клеточной подвижности протеинкиназой LOSK Следующая часть работы была посвящена изучению роли LOSK в клеточной миграции. К настоящему времени были получены предварительные данные о том, что активность этой киназы необходима для эффективной, направленной, клеточной миграции. Однако, пока неизвестно, какие сигнальные пути, регулируемые LOSK, участвуют в этом процессе .

Выбор экспериментальной модели для изучения миграции 5.6.1 .

клеток. Ингибирование LOSK приводит к нарушениям клеточной миграции Предварительные данные о влиянии LOSK на клеточную локомоцию были получены с использованием модели экcпериментальной раны монослоя (Бураков и Надеждина, 2010) .

Однако технически проще исследовать одиночные трансфицированные клетки в разреженной культуре, в которой каждая из клеток не касается соседней. Поэтому нами были проведены две серии экспериментов по изучению движения клеток, чтобы затем выбрать оптимальную экспериментальную модель для дальнейших исследований. Исследуемые клетки были трансфицированы доминантно-негативным мутантом LOSK, после чего проводили прижизненную цейтраферную видеосъёмку трансфицированных клеток (Рисунок 26а) .

Мы сравнили скорость и направленность движения одиночных клеток и выяснили, что клетки, экспрессирующие LOSK-K63RT, достоверно отличаются от контрольных лишь по направленности их движения, в то время как их скорость достоверно не различалась (Рисунок 26в). Также оказалось, что условия каждого из экспериментов могли отличаться: в некоторых случаях все клетки в одном опыте могли ползти значительно медленнее среднего. Поэтому в дальнейшем, в качестве экспериментальной модели выбрали рану монослоя, причём скорости опытных клеток измеряли в относительных единицах (как отношение скорости трансфицированной клетки к средней скорости двух нетрансфицированных соседних клеток – rexp/rcontrol). Также при использовании такого подхода мы установили, что направленность движения клеток в рану монослоя оказалась выше направленности движения одиночных клеток и составляла примерно 0,6-0,7 относительных единиц для контрольных клеток (отношение длины траектории движения клетки к её перемещению D/r) (см. рисунок 7). Данная величина отражает способность клеток двигаться прямолинейно, не меняя своего направления .

Рисунок 26. Клетки экспрессирующие LOSK-K63RT отстают по скорости и демонстрируют меньшую направленность движения в сравнении с контрольными клетками. (26а) Цейтраферная видеосъёмка клеток, зелёные клетки экспрессируют LOSK-K63RT. (26б) Подсчёт скорости и направленности движения клеток в рану монослоя (среднее±SE). (26в) Подсчёт скорости и направленности движения одиночных клеток, экспрессирующих LOSK-K63RT (среднее±SE) .

Также мы выяснили, что многие опытные (и некоторые контрольные) клетки при начале движения сразу обгонялись соседями и оказывались во втором слое, теряя, таким образом, возможность двигаться вместе с соседями. Это может объясняться не только способностью/неспособностью клетки ползти, но и также площадью края клетки, направленного в рану монослоя. Поэтому, в конечном счёте, для статистического обсчёта отбирали, во-первых, только те клетки, которые были способны двигаться в первом слое хотя бы на протяжении часа, во-вторых, имеющие передний край, составляющий не менее половины максимальной ширины клетки. Хотя такой подход в итоге приводил к тому, что разница скоростей и направленностей движения между опытными и контрольными клетками оказывалась меньше, зато он позволял получать однозначные достоверные результаты в каждом из экспериментов .

Таким образом, при изучении миграции клеток в экспериментальную рану монослоя мы обнаружили достоверное снижение скорости движения клеток на фоне ингибирования активности LOSK приблизительно в полтора раза (Рисунок 26б). Примерно во столько же раз снижалась и направленность клеточного движения. При изучении фильмов мы обратили внимание на то, что клетки, экспрессирующие LOSK-K63RT, намного хуже поляризовались в рану монослоя: чаще всего они не обладали выраженной ламеллой и пытались ползти сразу в двух или более направлениях. На раскадровке видно, что две трансфицированные клетки заметно отстают от своих соседей, оказываясь в итоге во втором слое мигрирующих клеток (Рисунок 26а). Это говорит о нарушенной поляризации клеток, что подтверждается предшествующими исследованиями по исследованию поляризации АГ в рану монослоя (Жаппарова, 2008) .

5.6.2. Точечная мутация RhoA в сайте фосфорилирования киназой LOSK приводит к изменению параметров клеточной подвижности В обзоре литературы было рассмотрен механизм инактивирования малой ГТФазы RhoA киназой LOSK, приводящий к расслаблению гладкомышечных клеток. Такой же сигнальный каскад может управлять и клеточным движением. Чтобы проверить эту гипотезу для начала мы экспрессировали в клетках нефосфорилируемую и имитирующую GFP-слитые фосфорилирование по сайту узнавания LOSK мутантную RhoA: GFP-RhoA-S188A и GFPКак видно на рис. 27 точечная замена серина на аланин резко снижает RhoA-S188E .

подвижность трансфицированных клеток: примерно в 2 раза снижается скорость клеток и их направленность. Во многих случаях клетки полностью останавливались и оставались во втором слое в течение всей съёмки. Точечная замена серина на глутаминовую кислоту в том же положении не вызывала подобного эффекта: имело место лишь небольшое снижение скорости движения, приблизительно на 15% по сравнению с контрольными клетками (Рисунок 27) .

Направленность же клеток, экспрессирующих GFP-RhoA-S188E, оставалась на уровне контрольных клеток. Исходя их этого, можно заключить, что нарушение фосфорилирования RhoA по сайту LOSK приводит к серьёзным нарушениям клеточной миграции .

Согласно литературным данным, RhoA-S188A не может быть инактивирована, в то время как RhoA-S188E находится в неактивном состоянии (Sauzeau et al., 2000; Ellerbroek et al., 2003;

Rolli-Derkinderen et al., 2006; Guilluy et al., 2008). Соответственно, негативный эффект синтеза RhoA-S188A на движение клеток может объясняться тем, что RhoA, обладающая избыточной активностью, способствует остановке клеток, например, за счёт избыточного образования стресс-фибрилл в клетке. В частности, при экспрессии в клетках RhoA дикого типа иногда наблюдается образование более плотных и многочисленных стресс-фибрилл. Забегая вперёд, стоит отметить, что такой ярко выраженный эффект мы наблюдали, экспрессируя в клетках нефосфорилируемую форму RhoA, и его отсутствие при экспрессии имитирующей фосфорилирование малой ГТФазы (см. главу 5.6.6. и рисунок 30). Мы провели серию экспериментов с другими генетическими конструкциями RhoA, чтобы проверить связь движения клеток с активностью малой ГТФазы RhoA .

Генетические конструкции, кодирующие GFP-слитые RhoA, 5.6.3 .

обладающие различной активностью, по-разному влияют на клеточную подвижность Далее мы провели серию экспериментов с GFP-слитыми RhoA дикого типа (RhoA-WT), доминантно-негативной (RhoA-T19N) и конститутивно-активной (RhoA-G14V) (Tatsis et al., 1998; Ghosh et al., 1999; Yoshioka et al., 1999). Каждая из этих генетических конструкций оказывала негативное влияние как на скорость, так и на направленность движения клеток (Рисунок 27). Особенно интересным оказался ингибирующий эффект RhoA дикого типа .

Известно, что для эффективной регуляции направленного движения клетки белок RhoA должен быть активен лишь в задней её части либо в течение коротких временных интервалов на её переднем крае (Etienne-Manneville and Hall, 2002; Ridley et al., 2003; Machacek et аl., 2009) .

Таким образом, в клетке должен существовать как пространственный, так и временной градиент распределения активности RhoA. Очевидно, что присутствие избыточного количества белка в клетке будет нарушать этот градиент, приводя впоследствии к нарушениям в клеточной подвижности .

Рисунок 27. Влияние различных мутантов RhoA на относительные скорость и направленность движения клеток (среднее±SE) .

При экспрессии доминантно-негативной, не способной обменивать ГДФ на ГТФ, RhoA снижение параметров клеточной подвижности не являлось настолько выраженным, как при экспрессии RhoA дикого типа (Рисунок 27). Клетки, экспрессирующие RhoA-T19N, зачастую двигались практически на уровне соседних, контрольных, клеток, отставая от них ближе к концу наблюдения. Меньше всего страдала скорость движения клеток, что ещё раз указывает на ограничительную роль RhoA в миграции клеток. Скорее всего, небольшой негативный эффект может также объясняться нарушением градиента активности RhoA внутри клетки. В случае же экспрессии конститутивно-активной RhoA, не способной гидролизовать ГТФ, происходило самое значительное снижение скорости движения клеток и нарушение направленности их движения, сравнимое с влиянием RhoA-S188A: способность двигаться у клеток практически полностью отсутствовала (Рисунок 27). Таким образом, полученные данные подтвердили наше предположение об обратной корреляции активности RhoA и клеточной подвижности .

Имитирующая фосфорилирование RhoA восстанавливает 5.6.4 .

скорость, но не направленность движения клеток на фоне ингибирования LOSK В первых экспериментах по «спасению» клеточной подвижности мы начали с котрансфекции клеток LOSK-K63RT и GFP-RhoA-S188E. Ввиду того, что GFP-RhoA-S188А сама по себе оказывала самый сильный негативный эффект на подвижность, котрансфекция её с LOSK-K63RT оказывала сильнейший ингибирующий эффект на движение клеток (см. таблицу 6 в приложении). В то же время RhoA-S188E в значительной мере восстанавливала скорость движения клеток с ингибированной LOSK: опытные клетки практически не отличались от контрольных (Рисунок 27б). Они могли довольно долго оставаться на переднем крае клеточного пласта, однако, их движение было довольно беспорядочным (Рисунок 27а). Кроме того, изначально поляризованные в сторону экспериментальной раны клетки могли терять поляризацию по ходу движения и начинать двигаться в других направлениях. Это приводило к тому, что направленность клеток оставалось низкой, и не отличалась от клеток, экспрессирующих одну лишь конструкцию LOSK-K63RT (Рисунок 27б). В данном случае восстанавливающий эффект RhoA-S188E не имеет простого объяснения. Если сам по себе связанный с GDI RhoA-S188E выступает в качестве «балласта», который не имеет выраженного эффекта на клеточную подвижность, то как же он способен восстанавливать нарушенное на фоне ингибирования LOSK движение? Возможно, здесь имеет место секвестрирование LOSKK63RT или какие-либо другие, пока неизученные механизмы. Тем не менее, такое восстановление подвижности указывает на то, что LOSK и RhoA тесно связаны друг с другом при регуляции клеточной локомоции .

Рисунок 28. Экспрессия RhoA-S188E восстанавливает скорость движения клеток, но не их направленность на фоне ингибирования LOSK. (28а) Цейтраферная видеосъёмка клеток, клетки в центре коэкспрессируют LOSK-K63RT и Подсчёт скорости и направленности движения клеток RhoA-S188A. (28б) коэкспрессирующих LOSK-K63RT и RhoA-S188A в рану монослоя (среднее±SE) .

Имитирующий фосфорилирование p150Glued способен частично 5.6.5 .

восстанавливать направленность движения клеток Следующий субстрат LOSK, участие которого в миграции клеток мы решили проверить, белок p150Glued. Во-первых, нами было показано, что фосфорилирование этого белка необходимо для его центросомной локализации и образования упорядоченной системы микротрубочек (Рисунок 14), во-вторых, этот же механизм оказался задействован в регуляции поляризации клеток, процесса, предшествующего направленному движению клеток (Zhapparova, et al., 2010). Исходя из этих соображений, такая регуляция p150Glued могла быть задействована и при направленной миграции клеток .

Для начала мы провели серию экспериментов по «спасению» клеточной подвижности, для чего клетки были котрансфицированы LOSK-K63RT и р150-3TE, а также LOSK-K63RT и р150-3TА. Во всех трёх случаях (LOSK-K63RT, LOSK-K63RT+р150-3TE, LOSKK63RT+р150-3TА) относительная скорость движения трансфицированных клеток была снижена практически одинаково, приблизительно на 30% (Рисунок 29б). Этот результат свидетельствует в пользу того, что фосфорилирование p150Glued киназой LOSK не влияет на скорость миграции клеток. Направленность клеток в 3-х экспериментах немного различалась, хотя и незначительно: коэкспрессия р150-3TА вместе с LOSK-K63RT дополнительно снижала направленность движения клеток, коэкспрессия с р150-3TЕ, наоборот, несколько восстанавливала. Несмотря на то, что направленность клеток, коэкспрессирующих LOSKK63RT и р150-3TЕ достоверно не отличалось от клеток, экспрессирующих одну лишь конструкцию LOSK-K63RT; достоверные различия были обнаружены между экспериментами по коэкспрессии LOSK-K63RT с р150-3TА или р150-3TЕ. Отсюда можно сделать осторожное заключение о том, что каким-то образом фосфорилированный p150Glued «помогает» клеткам держать направление движения, хотя этот эффект мог оказаться незамеченным при нашем способе оценки направленности. Действительно, внимательно изучив полученные фильмы, мы обратили внимание на то, что клетки, экспрессирующие LOSK-K63RT и р150-3TЕ, обладают выраженной ламеллой и способны длительное время находиться на переднем краю пласта мигрирующих клеток, хотя, в конечном счёте, они отставали от соседей (Рисунок 29а). На раскадровке таковыми являются две клетки в нижней части поля зрения. Их соседка, находящая чуть выше, экспрессирует значительно больше доминантно-негативной LOSK, чем p150-3TE, что приводит к тому, что она отстаёт первой в самом начале съёмки .

Рисунок 29. Экспрессия Glu-p150 частично восстанавливает направленность движения клеток и их поляризацию на фоне ингибирования LOSK или экспрессии RhoA-S188A. (29а) Цейтраферная видеосъёмка клеток, клетки в центре коэкспрессируют LOSK-K63RT и Glu-p150. (29б) Подсчёт скорости и направленности движения клеток коэкспрессирующих LOSK-K63RT и Glu-p150, LOSK-K63RT и Alap150, а также RhoA-S188A и Glu-p150 в рану монослоя (среднее±SE) .

Также мы провели коэкспрессию RhoA-S188A и р150-3TE, что привело к интересному результату: добавление имитирующего фосфорилирование p150Glued не оказало влияние на скорость движения клеток, хотя направленность их движения значительно возросла, приблизившись к таковой контрольных клеток (Рисунок 29б). Однако, полного восстановления направленности движения, как и в предыдущем эксперименте достигнуто не было, хотя такой положительный эффект указывает на тесную взаимосвязь между RhoA и p150Glued в процессах клеточной локомоции .

5.6.6. Ингибирование LOSK или экспрессия RhoA-S188A изменяют морфологию актинового цитоскелета Поскольку активность малой ГТФазы RhoA необходима для формирования ведущего края клетки и образования стресс-фибрилл в теле клетки, мы решили оценить влияние LOSK-K63RT, а также нефосфорилируемой и имитирующей фосфорилирование RhoA на морфологию актинового цитоскелета. Оказалось, что экспрессия RhoA-S188A, оказывающая сильный ингибирующий эффект на клеточную подвижность, приводит к образованию более многочисленных и/или более интенсивно окрашивающихся фаллоидином (возможно, более мощных) стресс-фибрилл. При экспрессии же RhoA-S188E система актинового цитоскелета не демонстрировала различий, либо стресс-фибриллы были менее выражены по сравнению с контрольными клетками (Рисунок 30) .

Рисунок 30. Система актинового цитоскелета в клетках, экспрессирующих RhoA-S188A или RhoA-S188E. Полимеризованный актин выявлен при помощи конъюгированного с TRITC фаллоидина .

Клетки, экспрессирующие LOSK-K63RT, однако, не демонстрировали существенных различий по сравнению с контрольными. Но, выявив актин в поляризованных, движущихся в рану клетках, мы обнаружили в них дефекты в формировании ведущего края; а именно, нарушения в формировании ламеллоподии ввиду отсутствия подлежащего ей слоя полимеризованного актина. (Рисунок 31) .

Рисунок 31. Система актинового цитоскелета в неполяризованных (сверху) или поляризованных клетках (снизу), экспрессирующих LOSK-K63RT .

Полимеризованный актин выявлен при помощи конъюгированного с TRITC фаллоидина .

Ингибитор RhoA-зависимой киназы p160ROCK восстанавливает 5.6.7 .

параметры клеточной подвижности на фоне ингибирования LOSK Так как в предыдущих экспериментах нами было показано, что ингибирование LOSK или повышенная активность её эффектора, RhoA, негативно влияют на подвижность клеток, мы решили проверить, будет ли ингибирование основного эффектора RhoA – киназы ROCKположительно влиять на движение клеток, трансфицированных RhoA-S188A и LOSK-K63RT .

Оказалось, что ингибирование ROCK при помощи Y27632 в концентрации 10 мкМ увеличивает абсолютную скорость движения как опытных, так и контрольных клеток примерно в полтора раза, то есть ограничивающий эффект RhoA на движение клеток подтвердился снова (Рисунок 32а). Более того, относительные скорость и направленность движения клеток, экспрессирующих RhoA-S188A и LOSK-K63RT, практически достигли уровня контрольных клеток (также обработанных Y27632), достоверно не отличаясь от них (Рисунок 33б-в) .

Однако, эффект восстановления скорости и направленности движения клеток с ингибированной LOSK не был связан с изменениями в системе микротрубочек: процент клеток с радиальными и близкими к радиальным микротрубочками оставался практически неизменным (Рисунок 32б) .

Рисунок 32. Ингибитор Rho-зависимой киназы ROCK снимает негативный эффект ингибирования LOSK или экспрессии RhoA-S188A. (32а) Абсолютные скорости клеток, мкм/ч (среднее±SE). (32б) Влияние ингибитора ROCK на систему микротрубочек, нарушенную экспрессией LOSK-K63RT (среднее±SD) .

–  –  –

Мы решили проверить, как влияют различные генетические конструкции RhoA на поляризацию клеток. Также как и в предыдущих экспериментах с мутантами p150Glued (Zhapparova et al., 2010) мы наблюдали за поляризацией АГ в рану монослоя через 3,5 часа после нанесения раны. В этих экспериментах мы подошли более строго к оценке поляризации АГ: в статистику включались только клетки первого ряда, кроме того, поляризованным считали АГ, большая часть которого локализовалась в передней четверти клетки (Рисунок 34а). Таким образом, мы отбирали только клетки, способные к движению, для большей достоверности получаемых данных .

Оказалось, что поляризация АГ была нарушена при экспрессии тех же генетических конструкций, которые более всего влияли на движение клеток: нефосфорилируемой RhoAS188A и конститутивно-активной RhoA-G14V (Рисунок 34б). То есть избыточная активность RhoA препятствовала нормальной поляризации АГ. Для остальных RhoA она оставалась высокой, примерно около 80% клеток были поляризованы .

При ингибировании LOSK примерно 45% клеток обладали поляризованным АГ. Этот результат ввиду иной методики подсчёта несколько отличался от полученных ранее данных (Zhapparova et al., 2010), но, тем не менее, негативный эффект генетической конструкции LOSK-K63RT был ярко выражен. Коэкспрессия её вместе с RhoA-S188A ещё больше уменьшала количество клеток с поляризованным АГ – до 40%. Коэкспрессия её же вместе с RhoA-S188Е наоборот, восстанавливала поляризацию АГ – почти до 65% (Рисунок 34б) .

Способность клеток к направленной миграции не зависит от 5.6.9 .

состояния системы микротрубочек, регулируемого LOSK Наконец, мы решили проверить, зависит ли способность клетки к направленному движению от системы её микротрубочек, иными словами, каков вклад радиальной системы микротрубочек, регулируемой LOSK, при движении клеток. Для этого мы решили оценить радиальность системы микротрубочек в клетках, экспрессирующих генетические конструкции, используемые нами. При экспрессии доминантно-негативной RhoA мы наблюдали падение числа клеток с радиальной системой микротрубочек (Рисунок 34г). Имитирующая фосфорилирование и нефосфорилируемая RhoA влияли на систему микротрубочек похожим образом. Наиболее негативный эффект оказывала конститутивно-активная RhoA. Получается, что в данном случае чётко выраженная связь между организацией микротрубочек и клеточным движением отсутствует, лишь в случае RhoA-G14V происходит нарушение обоих процессов .

При ингибировании p160ROCK на фоне ингибирования LOSK мы наблюдали небольшое восстановление системы микротрубочек в первые часы после воздействия Y27632, которое со временем пропадало (Рисунок 32б). С другой стороны, имитирующий фосфорилирование p150Glued, оказывающий слабое влияние на клеточную подвижность, был способен эффективно восстанавливать систему микротрубочек, нарушенную ингибированием активности LOSK, а также поляризацию АГ (Жаппарова, 2008; Zhapparova et al., 2010). Таким образом, в наших экспериментах мы выяснили, что однозначная связь между способностью клетки к направленному движению и системой её микротрубочек отсутствует .

Рисунок 34. Поляризация аппарата Гольджи и организация системы микротрубочек в клетках, экспрессирующих различные генетические конструкции. (34а) Оценка поляризации АГ: через 3,5 часа после нанесения раны монослоя клетки фиксировались. АГ визуализировали иммуноцитохимическим выявлением маннозидазы II. Либо же в качестве маркёра аппарата Гольджи использовалась экспрессия генетической конструкции АГ считали RFP-Golgi .

поляризованным при его расположении в передней четверти клетки. (34б) Поляризация аппарата Гольджи в клетках, экспрессирующих различные генетические конструкции. (34в) Пример радиальной и хаотичной системы микротрубочек, иммунофлуоресцентное окрашивание клеток при помощи антител к -тубулину. (34г) Организация системы микротрубочек в клетках, экспрессирующих различные генетические конструкции .

6. Обсуждение результатов

При скрининге пептидных библиотек была выявлена следующая последовательность для сайта узнавания LOSK/SLK: X-X-X-Y-X-T-Ф-R/K-X-X-X (Pike et al., 2008). Каждый из известных её субстратов лишь отчасти удовлетворяет этим требованиям, общим для всех них является наличие положительно заряженных и/или гидрофобных аминокислотных остатков после фосфорилируемого серина/треонина (чаще треонина). Получается, что LOSK не обладает высокой специфичностью по отношению к субстрату, либо же при её посадке на субстрат играют роль взаимодействия в других участках белка. При точечных заменах треонинов на аланины в сайте узнавания киназы в N-концевых участках белка p150Glued мы обнаружили, что каждый из них может быть фосфорилирован в присутствии каталитического домена LOSK, за исключением тройного мутанта p150-3TA (N) (Рисунок 8). Как было уже подмечено, при замене треонина 147 интенсивность фосфорилирования значительно падает, по сравнению с заменами в 145 и 146 положениях. Вероятно, именно последний треонин является более значимым, а остальные два в большей степени участвуют в создании сайта узнавания LOSK, хотя тоже могут быть фосфорилированы. Тем не менее, остаётся неизвестным, какое количество треонинов могут быть фосфорилироваными одновременно внутри одной молекулы белка. Этот вопрос мы планируем решить в будущем при помощи масс-спектрометрии .

Говоря о фосфорилировании белка p150Glued, мы подразумеваем его изоформу 1А, которая является минорной для большинства клеток за исключением нервной ткани (Жаппарова, 2008;

Zhapparova et al., 2009). Такое различие в уровнях экспрессии разных изоформ, свидетельствует о различной их роли в жизни клетки. При оверэкспрессии изоформа 1А связывается с микротрубочками по всей их длине, в то время как мажорная 1В-изоформа связывается с динамичными плюс-концами микротрубочек: она же участвует в динеиновом транспорте по микротрубочкам (Рисунок 3в). Такое фосфорилирование по уникальному сайту в вариабельном участке p150-1А, найденному в работе Жаппаровой О. (Жаппарова, 2008), создаёт возможность для её специфической регуляции. Однако, неизвестно, насколько значителен вклад 1Аизоформы в транспорт грузов по микротрубочкам .

N-концевые участки p150Glued, содержащие мутации R148W и R149Q, демонстрировали повышенное фосфорилирование посредством каталитического домена LOSK по сравнению с белком дикого типа (Рисунок 9а). Вероятно, в клетках не нервного происхождения такое фосфорилирование не может оказывать сильного негативного эффекта на их жизнедеятельность, учитывая минорное содержание в них 1А-изоформы; даже, наоборот, оно будет способствовать формированию упорядоченной системы микротрубочек и поляризации мигрирующих клеток (Zhapparova et al., 2009; Zhapparova et al., 2010). В клетках нервной ткани содержание этой изоформы повышено, одна из её функций заключается в регуляции динамики микротрубочек, причём изоформа 1В скорее всего не вовлечена в этот процесс ввиду её меньшего сродства к микротрубочкам (Zhapparova et al., 2009; Lazarus et al., 2013) .

Фосфорилирование 1А-изоформы p150Glued ослабляет её взаимодействие с микротрубочками (Жаппарова, 2008); в частности, известно, что именно снижение сродства «длинной» изоформы p150Glued к микротрубочкам в нервных клетках лежит в основе синдрома Перри (Lazarus et al., 2013; Ishikawa et al., 2014). Соответственно, нарушение этого механизма может лежать в основе патогенеза этого и других нейродегенеративных заболеваний. Логичным продолжением этого исследования будет изучения взаимодействия R148W и R149Q мутантов p150Glued с микротрубочками .

В следующей части работы нами было выяснено, что имитирующий фосфорилирование Glu-p150 обладает большим сродством к центросоме, чем его нефосфорилируемый аналог (Рисунок 14). Известно, что эндогенный p150Glued теряет свою центросомную локализацию на фоне ингибирования LOSK (Burakov et al., 2008a), а фосфорилированный p150Glued в таком случае способен восстанавливать систему микротрубочек (Жаппарова, 2008). Суммируя эти p150Glued, данные, можно заключить, что такое изменение статуса фосфорилирования способствующее его центросомной локализации, ответственно за радиальную организацию микротрубочек в клетке. Кроме того, излишняя стабилизация микротрубочек, происходящая при связывании с ними нефосфорилированного p150Glued или Ala-p150, тоже может вносить вклад в нарушение организации микротрубочек, чему препятствует киназа LOSK .

При заменах двух первых треонинов (T145-146A и T145-146Е) мы наблюдали схожий эффект локализации Glu-p150 на центросоме клетки (Рисунок 14). Тем не менее, процент клеток, содержащих р150-2ТА на центросоме, был несколько выше, чем в случае 3ТА-мутанта .

Учитывая, что при замене треонинов 145-146 на аланин фосфат по-прежнему мог включаться в состав молекулы (рис.8), наличие одного фосфата в составе молекулы p150Glued является достаточным для увеличения её сродства к центросоме. Кроме того этот результат подтверждает значимость 147-ого треонина для фосфорилирования белка. Мутанты p150Glued, содержащие 2 замены треонина на глутаминовую кислоту, локализовались на центросоме в таком же проценте клеток, как и мутанты с тремя аминокислотными заменами. Хотя неизвестно, может ли фосфорилироваться 147 треонин в случае 2ТЕ-мутанта p150Glued, мы предполагаем, что наличие двух фосфатных групп является достаточным для центросомной локализации этого белка. Связанный с центросомой, фосфорилированный p150Glued, вероятно, выполняет свои функции по удержанию микротрубочек в составе динактинового комплекса, что подтверждают наши эксперименты с иммунопреципитацией GFP-слитых Ala-p150 и Glup150 из клеток (Рисунок 10) .

Известно, что в митозе p150Glued подлежит регуляции киназой Аврора А, действие которой сходно с LOSK: множественное фосфорилирование микротрубочко-связывающего домена p150Glued предотвращает его связь с микротрубочками, что способствует его накоплению на полюсах деления клетки (Rome et al., 2010). Вероятно, в обоих случаях задействован один и тот же механизм: добавление отрицательных зарядов в участок, отвечающий за связывание с микротрубочками, нарушает связь с ними. Что же касается центросомной локализации, здесь имеет место специфическое связывание p150Glued с каким-то другим центросомным белком. С какими партнёрами взаимодействует фосфорилированный динактин на центросоме, а также сколько фосфатов участвуют в таком его таргетировании, на данный момент неизвестно. Для того, чтобы это определить нужно будет идентифицировать связывающиеся с вариабельным участком p150Glued белки. Мы планируем изучить этот вопрос в дальнейших исследованиях .

p150Glued может непосредственно участвовать в удержании микротрубочек на центросоме посредством остальных компонентов динактина или даже динеинового комплекса или же участвовать в доставке других заякоривающих микротрубочки компонентов. Учитывая, что большинство связанных с микротрубочками центросомных белков, таких как найнеин, гамматубулин, перицентрин остаются связаными с ней при экспрессии доминантно-негативной LOSK, а также при ингибировании динеина (Burakov et al.,2008; Burakov et al., 2008a), можно заключить, что динактиновый комплекс непосредственно принимает участие в удержании микротрубочек на центросоме. А регуляция организации микротрубочек киназой LOSK заключается именно в таргетировании динактинового комплекса через белок p150Glued на центросому клетки, где он заякоривает микротрубочки, формируя радиальную систему .

На данный момент основным партнёром p150Glued на центросоме считается PCM-1, благодаря которому первый может удерживаться на ней. Но, в то же время PCM-1 транспортируется на центросому по микротрубочкам, связавшись с p150Glued через адаптер Par6 (Kodani et al., 2010). В данной работе авторы не делали различия между 1А и 1Визоформами p150Glued, поэтому, предположительно, обе его изоформы могут удерживаться таким образом на центросоме. Однако учитывая тот факт, что при ингибировании LOSK происходит снижение содержания общего количества белка p150Glued (обеих 1А и 1В изоформ, которые невозможно различить при помощи антител) на центросоме (Burakov et al., 2008a), можно придти к заключению, что, во-первых, изоформа 1А играет исключительную роль в центросомной локализации динактинового комплекса и организации микротрубочек, вовторых, именно она способна связываться с локализованным на центросоме белком PCM-1 .

Изоформе 1В в данном случае отдаётся роль в осуществлении транспорта в составе динеиндинактинового комплекса. Таким образом, более вероятной представляется следующая модель:

транспорт белка происходит благодаря наличию радиально организованных PCM-1 микротрубочек через связь через p150Glued с динеин-динактиновым комплексом. Удержание же микротрубочек на центросоме происходит посредством динактинового комплекса через p150Glued, входящую в его состав 1А-изоформу вероятно, взаимодействующую с локализованным на центросоме белком PCM-1 .

Однако, принимая во внимание результаты экспериментов по нарушению радиальной системы микротрубочек в клетках при использовании ингибитора киназы GSK-3 (Рисунок 21), можно прийти к выводу, что влияние LOSK-K63RT на локализацию PCM-1 опосредовано её участием в организации микротрубочек. Этот результат хорошо соотносится с данными других авторов, согласно которым PCM-1 транспортируется на центросому при помощи динеиндинактинового комплекса (Kubo et al., 1999; Dammermann and Merdes, 2002; Kodani et al., 2010) .

Для осуществления этого процесса в клетке должны существовать свободный динактин, способный связываться с активным динеином, без его переизбытка, и радиальная система микротрубочек. Таким образом, мы приходим к тому, что активность киназы LOSK нужна для обеспечения эффективного внутриклеточного транспорта, причём это не регуляция активного транспорта по микротрубочкам как таковая, а регуляция направленности путей этого транспорта. Киназа LOSK участвует в создании радиальной системы микротрубочек путём таргетирования p150Glued на центросому клетки; в свою очередь радиальная организация микротрубочек способствует эффективной доставке компонентов клетки в места их назначения .

В наших экспериментах мы обнаружили, что ингибирование LOSK не приводит к каким-либо изменениям в активности динеина: активная составляющая движения ERGIC53-содержаших везикул не претерпевала никаких изменений (Рисунок 12б). Однако она полностью пропадала при ингибировании динеина путём экспрессии СС1. Эффект этой генетической конструкции, как уже было сказано, заключается в ингибировании активности динеинового мотора (Жаппарова, 2008; Tripathy et al., 2014) - при её экспрессии мы наблюдали полное исчезновение процессивного транспорта, включая и кинезин-зависимое движение от центра клетки. Этот эффект может объясняться тем, что для работы какого-либо из моторов, кинезина или динеина, необходимо присутствие его антагониста, то есть, в отсутствии одного из моторов, прекращается двунаправленный транспорт в клетке (Ally et al., 2009) .

Радиальная система микротрубочек, хотя и является классическим модельным объектом для изучения, тем не менее, не является характерной для большинства типов клеток. Вероятно, её образованию способствует определённая морфология клеток, растущих на двумерном субстрате. Соответственно, радиальная организация микротрубочек является наиболее удобной для переноса различных грузов внутри клетки, позволяя осуществлять максимально эффективный транспорт, как к центру клетки, так и от него (Бураков, 2014). Несмотря на то, что такая организация микротрубочек характерна для культивируемых клеток, она, тем не менее, отражает реальные процессы, происходящие in vivo; поскольку основные свойства ЦОМТов, такие как нуклеация и удержание микротрубочек, а также участие моторных белков в транспорте по микротрубочкам, остаются неизменными. В наших экспериментах самым ярким эффектом ингибирования LOSK было нарушение радиальной системы микротрубочек (Рисунок 11а-б), причём оно не было связано с какими-либо нарушениями в сборке (Рисунок 10) или функционировании динеин-динактинового комплекса (Рисунок 12). Мы выяснили, что такая дезорганизация системы микротрубочек приводит к нарушению доставки как компонентов центросомы (Рисунки 16, 21, 22), так и аппарата Гольджи (Рисунок 13). Таким образом, данная протеинкиназа участвует в создании путей внутриклеточного транспорта, координируя доставку компонентов клетки в места их назначения .

Что касается участия LOSK в регуляции образования первичных ресничек: нужно представлять, что ресничка является стабильной структурой, образующейся после митотического деления клетки. При транзиентной трансфекции, как правило, её эффект можно наблюдать сразу после прохождения клетками митоза. Соответственно, можно предположить, что незначительное влияние LOSK-K63RT на образование первичных ресничек может объясняться тем, что максимальный эффект синтеза доминантно-негативной LOSK проявляется уже после сборки этой структуры. Таким образом, единожды сформированная, ресничка сохраняет свою стабильность. Некоторое остаточное количество РСМ-1 в её основании может также способствовать устойчивости реснички к влиянию LOSK-K63RT (Рисунок 22б). Это предположение подтверждается нашими наблюдениеми за клетками с полностью диспергированным по цитоплазме клеток на фоне ингибирования LOSK белком PCM-1: при полном проявлении эффекта доминантно-негативной конструкции формирование первичных ресничек было в значительной степени нарушено (см. раздел 5.4.4.) .

Примечательно, что 1А-изоформа p150Glued не только может участвовать в организации микротрубочек: она также вовлечена в поляризацию движущихся клеток. При стимуляции клеток к миграции эта изоформа начинает связываться с микротрубочками, направленными в сторону движения (Zhapparova et al.,2009). Также, фосфорилированная киназой LOSK, она каким-то образом участвует в поляризации АГ в направлении миграции (Zhapparova et al., 2010). Возможно, это определяется лишь системой микротрубочек в клетке, поскольку фосфорилирование p150Glued определяет образование радиальной системы центросомных микротрубочек, а центросомные микротрубочки, в свою очередь отвечают за поляризацию АГ в независимости от его способности к нуклеации собственных микротрубочек (Vinogradova et al., 2012). Также фосфорилированный p150Glued может участвовать во взаимодействиях с какимилибо белками АГ, способствуя его позиционированию, однако, на данный момент в наших экспериментах мы не смогли обнаружить каких-либо отличий в связывании Ala-p150 или Glup150 с АГ .

Кроме динактина-1 на сегодняшний день не известно других субстратов LOSK, связанных с АГ, поэтому регуляция организации микротрубочек на АГ посредством LOSK представляется маловероятной, посколько фосфорилирование р150Glued, вероятно, отвечает только за его центросомную локализацию. Действительно, изучив участие LOSK в этом процессе, мы обнаружили, что ингибирование активности LOSK практически не оказывало влияние на организацию микротрубочек в клетках BS-C-1, способных эффективно организовывать микротрубочки посредством АГ (Рисунок 24). Также мы наблюдали, что при ингибировании активности динеина путём экспрессии СС1, микротрубочки по-прежнему могли нуклеироваться от АГ. Кроме того, при принудительной посадке р150 на АГ, мы не наблюдали перераспределения микротрубочек к поверхности АГ (данные не указаны). Также ярким примером являлось образование радиальной системы микротрубочек в цитопластах клеток BSC-1 (Рисунок 25): большинство из них демонстрируют упорядоченную систему микротрубочек, в отличие от цитопластов Vero, не образующих радиальную систему микротрубочек в отсутствие центросомы (Бродский, 2010). Возможно, в клетках BS-C-1 киназа LOSK изначально является менее активной, чем в клетках линии Vero: несмотря на сравнимую центросомную нуклеацию, микротрубочки заякориваются менее активно, что приводит к появлению большего числа клеток с запутанными микротрубочками. В этот момент реализуется возможность участия АГ в качестве ЦОМТ. Какие сигнальные пути активируются при таком переходе – на сегодняшний день неизвестно. Мы предполагаем участие белка CLASP2 и связанной с ним киназы GSK-3 в этом процессе (в клетках BS-C-1 наблюдается повышенная экспрессия CLASP2 и активность GSK-3) .

Хотя АГ чаще всего переориентируется в направлении движения клетки в экспериментах in vitro, тем не менее, его поляризация скорее является следствием запущенного процесса миграции и активации определённых сигнальных путей в конкретных условиях. В наших экспериментах мы наблюдали корреляцию между движением клеток и поляризацией АГ в большинстве случаев. Известно, что при миграции по узким бороздкам в субстрате (в условиях ограниченного пространства) АГ часто локализован на заднем краю мигрирующей клетки, где также может располагаться и центросома (Pouthas et al., 2008). Наблюдая за миграцией клеток BS-C-1, используемых в вышеупомянутой работе, мы обнаружили, что на двумерном субстрате они также мигрируют, избегая поляризации АГ в сторону движения. Кроме того экспрессия доминантно-негативной LOSK не нарушала направленную миграцию этих клеток (данные не указаны). Скорее всего, это связано с активацией/деактивацией различных сигнальных путей, таких как, например, вероятное снижение активности LOSK и наблюдаемое нами повышение активности GSK-3. Также клетки способны мигрировать на 2D субстрате и при отсутствии центросомы и АГ на переднем краю клетки, например при ингибировании Rho-зависимой киназы (Magdalena et al., 2003). Вероятно, этот процесс не является обязательным при движении клеток, хотя чаще всего поляризация АГ является хорошим критерием общей поляризации клетки при наличии достаточного пространства для её миграции .

Основную роль в перемещении клеток, конечно, играет актомиозиновая система, хотя микротрубочки также необходимы для направленной миграции многих типов клеток (Vasiliev et al., 1970). LOSK регулирует обе цитоскелетных системы, задействованные в движении клеток (Рисунок 5), хотя её влияние на актиновый цитоскелет является довольно спорным, ввиду отсутствия чётких экспериментальных доказательств. В наших экспериментах мы не наблюдали выраженного влияния доминантно-негативной LOSK на систему стресс-фибрилл в клетке, хотя некоторые авторы утверждали о разборке стресс-фибрилл в клетках при внесении в них LOSK-K63RT (Sabourin et al., 2000). В действительности, при ингибировании LOSK мы наблюдали как клетки с более плотными пучками актина, так и с разобранными стрессфибриллами. В первом случае, такие различия могут быть объяснены как частичным или полным замещением функций LOSK другими киназами (LOK, цАМФ, гАМФ-зависимые киназы), а во втором - запуском клеточной гибели, связанной с подавлением активности LOSK .

Дефекты образования ламеллы на ведущем крае мигрирующей клетки, вызываемые ингибированием активности LOSK, скорее всего, свидетельствует о нарушении Arp2/3зависимой полимеризации актина, что может быть результатом избыточной активности RhoA и последующем ингибировании процессов, связанных с активностью малых ГТФаз Rac1 и Cdc42 (Macharek et al., 2009). Так или иначе, эти вопросы на данный момент не разрешёны и требуют дальнейшего изучения .

Активность LOSK приводит к образованию упорядоченной системы микротрубочек (Burakov et al., 2008) и в тоже время влияет на подвижность клеток (Wagner et al., 2008; Roovers et al., 2009; Бураков и Надеждина, 2010). Соответственно, ингибирование активности киназы приводит к нарушению обоих процессов. Мы решили проверить, насколько эти события связаны между собой, другими словами, является ли влияние LOSK на движение клеток опосредованным радиальной организацией микротрубочек, и, наоборот, приводит ли ингибирование к аналогичным изменениям в клетке? Или же организация RhoA микротрубочек, а также поляризация клеток и их подвижность, регулируемые LOSK, являются несвязанными друг с другом процессами. Оказалось, что Glu-p150, способный восстанавливать систему микротрубочек и поляризацию АГ на фоне экспрессии LOSK-K63RT (Zhapparova, 2010), не имел значительного эффекта на восстановление клеточной подвижности (Рисунок 28) .

Однако, можно было заметить, что клетки коэкспрессирующие Glu-p150Glued и LOSK-K63RT, долгое время двигаются направленно до того момента пока они не окружаются соседями, сразу же после этого теряя возможность направленно ползти. Эксперименты с коэкспрессией Glup150 и Ala-RhoA также подтверждают роль фосфорилированного p150Glued в обеспечении направленности движения: в этом случае клетки могут некоторое время двигаться направленно до того момента, пока их не вытеснят более быстрые соседи (Рисунок 29). Направленность движения хотя и не достигала уровня контрольных клеток, но достоверно возрастала по отношению к направленности клеток, экспрессирующих только лишь Ala-RhoA .

С другой стороны RhoA-S188E положительно влиял на скорость передвижения клеток с ингибированной LOSK (Рисунок 27), хотя и в этом случае траектории движения клеток оставались более хаотичными по сравнению с контрольными клетками. Ингибитор ROCK, Y27632, успешно восстанавливал скорость движения клеток, экспрессирующих LOSK-K63RT (или Ala-RhoA), хотя система микротрубочек в клетках не показывала значительного улучшения при его действии (Рисунок 32). В то же время при экспрессии Ala-RhoA или GluRhoA система микротрубочек в клетках была практически неотличима (Рисунок 34г). Другими словами, активность LOSK положительно влияет на систему микротрубочек, воздействуя через p150Glued, а не через RhoA. Таким образом, здесь мы можем разделить два сигнальных пути от LOSK: один через p150Glued, приводящий к радиальной организации микротрубочек, другой через RhoA, участвующий в движении клеток. Причём каждый из них в некоторой степени влияет на поляризацию клеток (Рисунок 35). В этом случае может иметь место mDia1зависимая регуляция структуры и положения АГ и центросомы, происходящая при умеренной активации RhoA (Zilberman et al., 2011; Chang et al., 2015). Этот процесс может быть скоординирован с накоплением фосфорилированного p150Glued на переднем краю мигрирующей клетки (Жаппарова, 2008), что будет приводить к избирательной стабилизации «смотрящих»

вперёд микротрубочек и поддержанию направленного движения (Cook et al., 1998; Wen et al., 2004), а также помогать позиционированию АГ. Также известно, что ингибирование ROCK ускоряет скорость миграции клеток, но параллельно с этим, ухудшает поляризацию центросомы и АГ в сторону движения клеток (Magdalena et al., 2003), то есть активности одного лишь mDia1 недостаточно для обеспечения поляризации клеток, и в данном случае фосфорилированный р150Glued может его дополнять. При избыточной активации mDia1 обычно наблюдается диспергирование АГ (Zilberman et al., 2011), чего мы не наблюдали в наших экспериментах; отсюда можно предположить, что основной сигнальный путь, нарушаемый синтезом LOSK-K63RT, вероятно, приводит к активации киназы ROCK, что также подтверждают наши эксперименты с воздействием Y27632 на клетки (Рисунки 32, 33) .

Подводя итог, можно заключить о наличии 2-х сигнальных путей, регулируемых LOSK .

Оба положительно влияют на поляризацию центросомы и АГ движущихся клеток. Инактивация RhoA киназой способствует повышенной скорости миграции клеток. А фосфорилирование р150Glued положительно влияет на направленность движения клеток. На рис. 35 изображены процессы, регулируемые этой киназой, посредством 2-х её субстратов - p150Glued и RhoA. На самом деле эта картина выглядит гораздо сложнее: практически каждый из участников нисходящих сигнальных путей от LOSK может каким-то образом влиять на остальные .

Например, система микротрубочек каким-то образом может способствовать направленному движению клеток, как и определять их поляризацию. В то же время от динамики микротрубочек может зависеть активность малых ГТФаз и локализация динактинового комплекса. На данной схеме отображены основные события, происходящие при миграции клеток. Скорее всего, киназа LOSK/SLK играет координирующую роль при направленной миграции клеток, используя малое число мишеней, что мы могли наблюдать в наших экспериментах по «спасению» клеточной подвижности .

Существует ещё один субстрат LOSK, принимающий участие в локомоции клеток. Это белок фокальных контактов – паксиллин (Quizi et al., 2012). Однако, как кажется, его фосфорилирование является необходимым лишь для осуществления одного процесса сборки/разборки фокальных контактов (focal adhesion turnover). Но это не является универсальным механизмом регуляции этого процесса. Паксиллин может быть фосфорилирован различными киназами по разным аминокислотным остаткам, что лежит в основе регуляции динамики фокальных контактов (Qin et al., 2015) .

Пожалуй, одним из самых сложным вопросом является действие различных генетических конструкций на физиологию клеток. При замене инвариантного лизина на аргинин в активном центре многих серин-треониновых киназ происходит инактивация их активности с сохранением способности связывать АТФ и субстрат (Li et al., 1995). Таким образом, механизм действия доминантно-негативной LOSK-K63RT, вероятно, заключается в конкурентном ингибировании активности эндогенного белка (Burakov et al., 2008). Учитывая наличие нескольких мишеней для киназы в клетках, положительный эффект от внесения имитирующих фосфорилирования субстратов может заключаться как непосредственным их участием в биохимических процессах клетки, так и простым секвестрированием избытка доминантно-негативного белка, позволяющим эндогенной протеинкиназе осуществлять свои функции. Однако, последний механизм не исключает первого, что подтверждается экспериментами с внесением и нефосфорилируемых мутантов, на фоне ингибирования активности LOSK. А именно, нефосфорилируемый субстрат, забирая на себя избыток доминантно-негативной киназы, тем не менее, не способен участвовать в нисходящих сигнальных путях, в то время как имитирующий фосфорилирование белок может реализовать свои функции в клетке. Так или иначе, в результате наших экспериментов мы можем делать выводы о реальных процессах, происходящих в клетке .

Рисунок 35. Схема, демонстрирующая участие LOSK в процессах движения клеток, их поляризации и организации микротрубочек (пояснение в тексте) .

–  –  –

В настоящей работе впервые изучена роль серин-треониновой киназы LOSK/SLK в процессах внутриклеточного транспорта, организации микротрубочек и направленной миграции клеток. Установлено, что фосфорилирование компонента динактина – белка p150Glued осуществляется по треонинам 145-147 и приводит к центросомной локализации динактина и обеспечению организации радиальной системы микротрубочек. Активность LOSK, приводя к формированию упорядоченной системы микротрубочек в клетке, увеличивает эффективность транспорта в долговременных событиях, влияя на транспорт как центросомных белков, так и компонентов аппарата Гольджи. В то же время, активность данной киназы не затрагивает непосредственное функционирование динеин-динактинового комплекса и не влияет на организацию микротрубочек посредством аппарата Гольджи .

Регуляция киназой LOSK направленной миграции клеток оказалась опосредованной фосфорилированием двух её субстратов – p150Glued и RhoA. Причём фосфорилирование p150Glued отвечает только за организацию микротрубочек и поляризацию клеток, а фосфорилирование RhoA за обеспечение скорости движения клеток и в какой-то мере их поляризации. Таким образом, выяснены молекулярные механизмы, лежащие в основе регуляции киназой LOSK вышеописанных процессов жизнедеятельности клеток .

8. Выводы

белке p150Glued (динактине-1)

1. Мутации R148W и R149Q в не препятствуют его фосфорилированию киназой LOSK по треонинам 145-147, и, возможно, даже усиливают это фосфорилирование .

2. Фосфорилирование белка p150Glued киназой LOSK по треонинам 145-147 способствует центросомной локализации динактина, но не влияет на сборку динактинового комплекса .

3. Ингибирование киназы LOSK приводит к нарушению эффективности внутриклеточного транспорта в долговременных событиях, но не оказывает влияния на мгновенную скорость перемещения везикул в клетке .

4. Активность LOSK необходима для центросомной локализации белка PCM-1, вероятно, за счёт образования упорядоченной системы микротрубочек с центром в центросоме. При этом ингибирование LOSK не препятствует сборке первичных ресничек в клетках .

5. Ингибирование киназы LOSK не отражается на организации микротрубочек на мембранах аппарата Гольджи .

6. Ингибирование киназы LOSK приводит к снижению скорости и направленности миграции фибробластоподобных клеток, а также к нарушениям их поляризации и формирования ламеллоподии на краю раны монослоя. Аналогичный эффект вызывает синтез в клетках нефосфорилируемого по Ser188 мутанта малой ГТФазы RhoA .

7. На фоне ингибирования киназы LOSK синтез в клетках имитирующей фосфорилирование по Ser188 малой ГТФазы RhoA способен восстанавливать скорость передвижения клеток и отчасти их поляризацию, а синтез имитирующего фосфорилирование белка p150Glued восстанавливает поляризацию клеток, но не их подвижность .

8. Ингибирование основного эффектора RhoA – киназы р160ROCK - приводит к снятию негативного эффекта на движение клеток нефосфорилируемой RhoA и доминантнонегативной киназы LOSK .

9. Активность киназы LOSK обеспечивает подвижность клеток независимо от образования упорядоченной системы микротрубочек .

9. Список сокращений

АГ – аппарат Гольджи АТФ - аденозинтрифосфат БФА – брефелдин А ГДФ - гуанозиндифосфат ГТФ – гуанозинтрифосфат кДа - килодальтон мДа – мегадальтон ПААГ – полиакриламидный гель ПЦР – полимеразная цепная реакция цАМФ/цГМФ – циклический аденозин/гуанозин монофосфат ЦОМТ – центр организации микротрубочек ЭДТА - этилендиаминтетраацетат ЭПР – эндоплазматический ретикулум BCIP/NBT – 5-bromo-4-chloro-3'-indolyphosphate/nitro-blue tetrazolium Cap-Gly-домен (Cytoskeleton Associated Protein – Gly-rich) CC – coiled-coil Cy5 - Cyanine dye 5 DMSO – Dimethyl sulfoxide dNTP - deoxyribonucleotide triphosphate ERES – endoplasmic reticulum exit site ERGIC- endoplasmic reticulum-Golgi intermediate compartment FITC - Fluoresceinisothiocyanate HA - Human influenza hemagglutinin GAP - GTPase-activating protein GDI – guanine dissociation inhibitors GEF - guanine nucleotide exchange factor GRIP - Golgin-97, RanBP2alpha, Imh1p, P230/golgin-245 IPTG - Isopropyl -D-1-thiogalactopyranoside МАР – microtubule associated proteins PBS – phosphate buffered saline PIPES - piperazine-N,N-bis(2-ethanesulfonic acid) Rpm – revolutions per minute (оборотов в минуту) SD – standart deviation (стандартное отклонение) SE – standart error of the mean (стандартная ошибка измерения среднего) TBS – tris buffered saline TEMED – tetramethylethylenediamine TGN - trans-Golgi network TRITC - Tetramethylrhodamine

-TuRC - -tubulin ring complex

-TuSC - -tubulin small complex

–  –  –

AKAP450 - A-kinase anchoring protein 450 APC - adenomatous polyposis coli protein ARL4A - ADP-ribosylation factor-like 4A Arf - ADP-ribosylation factor Arp – actin related protein Arp2/3 - actin related protein 2 and 3 ASK-1 - apoptosis signal-regulating kinase AT2R - angiotensin II type 2 receptor Bcl-2 - B-cell lymphoma 2 protein BBS4 - Bardet-Biedl syndrome 4 protein BICD2 - Bicaudal D2 CAP350 - Centrosome-Associated Protein 350 CapZ - Capping protein in muscle Z-line Cdc2 - cell division cycle protein Cdc42 - cell division cycle 42 СK2 – casein kinase CLASPs - CLIP-associating proteins CLIPs - cytoplasmic linker proteins DNA-PK - DNA-dependent protein kinase EB – end bounding proteins FAK – foсal adhesion kinase FOP - FGFR1 (fibroblast growth factor receptor 1) oncogene partner HA - Human influenza hemagglutinin HER2/ErbB2/Neu - human epidermal growth factor receptor 2 / erythroblastosis oncogene B / neural glioblastoma GCC185 - GRIP coiled-coil protein GCK - germinal center kinase GCP – -tubulin complex protein GFP – green fluorescent protein GM130 – Golgi matrix protein 130 GMAP-210 - Golgi microtubule-associated protein 210 GSK-3 – glycogen synthase kinase (3 - изоформа) GST - Glutathione S-transferase KIFC3 - kinesin family member C3 Lis1 - lissencephaly 1 protein LOK - lymphocyte-oriented kinase LOSK - Long Ste20-like kinase mDia - mammalian homolog of Drosophila diaphanous MLCK - Мyosin light chain kinase NudE – nuclear distribution E protein PAK - p21-activated kinase PCM1 - pericentriolar material 1 protein PH-PAK - Plecstrin-Homology domain p21-Activated Kinases PKN - protein kinase N Plk1 – Polo-like kinase 1 Rab6 - Ras-like GTP-binding protein Rac1 - Ras-related C3 botulinum toxin substrate 1 Ran - Ras-related nuclear protein RhoA – Ras homologous member A ROCK (p160ROCK) - rho-associated, coiled-coil-containing protein kinase 1 SAS6 – spindle assembly 6 protein SLK - Ste20-like kinase Smurf1 - SMAD specific E3 ubiquitin protein ligase 1 TACC - Transforming acidic coiled coil protein Tctex-1 - t complex-testis expressed-1 WASP - Wiskott–Aldrich syndrome protein XMAP215 - Xenopus microtubule associated protein

–  –  –

Бродский И. Б. Внецентросомные детерминанты организации микротрубочек в интерфазных клетках: дис. …канд. биол. наук: 03.03.04 / Бродский Илья Борисович. – М., 2010 .

– 76 с .

Бураков А. В. Цитоскелет как система путей внутриклеточного транспорта в клетках животных: дис. …док. биол. наук: 03.03.04 / Бураков Антон Владимирович. – М., 2014. – 232 с .

Бураков А. В., Надеждина Е. С. / Динеин и динактин как организаторы системы клеточных микротрубочек. // Онтогенез – 2006 – 35(5) - с. 1-17 .

Бураков А. В., Надеждина Е. С. / Протеинкиназа LOSK в регуляции сети микротрубочек и в клеточной локомоции. // Биофизика – 2010 - 55(6) – с. 996-1001 .

Жаппарова О.Н., Бураков А.В., Надеждина Е.С. / Динеин-динактиновый комплекс необходим для удержания, но не для нуклеации микротрубочек на центросоме. // Биохимия – 2007 – 72(11) - с. 1515 – 1524 .

Жаппарова О. Н. Роль динеин-динактинового комплекса в организации системы микротрубочек в интерфазных клетках: дис. …канд. биол. наук: 03.00.03 / Жаппарова Ольга Наилевна. – М., 2008. – 102 с .

Потехина Е. С. Субстратная специфичность и регуляция активности Ste20 – подобных протеинкиназ LOSK, участвующих в индукции апоптоза: дис. …канд. биол. наук: 03.00.03 / Потехина Екатерина Сергеевна. – М., 2001. – 105 с .

Узбеков Р., Алиева И. Центросома - история изучения и новые открытия. От цитоплазматической гранулы до центрального комплекса внутриклеточной регуляции. — Издательство Московского Университета Москва, 2013. — С. 320 Abal M, Piel M, Bouckson-Castaing V, Mogensen M, Sibarita JB, Bornens M / Microtubule release from the centrosome in migrating cells. // J Cell Biol. – 2002 - 159(5) – p. 731–737 .

Adachi A, Kano F, Tsuboi T, Fujita M, Maeda Y, Murata M. / Golgi-associated GSK3beta regulates the sorting process of post-Golgi membrane trafficking. // J Cell Sci. - 2010 - 123(19) - p .

3215-25 .

Ally S, Larson AG, Barlan K, Rice SE, Gelfand VI. // Opposite-polarity motors activate one another to trigger cargo transport in live cells. // J Cell Biol. – 2009 - 187(7) – p. 1071-82 .

Andersen JS, Wilkinson CJ, Mayor T, Mortensen P, Nigg EA, Mann M. / Proteomic characterization of the human centrosome by protein correlation profiling. // Nature - 2003 - 426(6966)

– p. 570-4 .

Askham JM, Vaughan KT, Goodson HV, Morrison EE. / Evidence that an interaction between EB1 and p150(Glued) is required for the formation and maintenance of a radial microtubule array anchored at the centrosome. Mol Biol Cell. - 2002 - 13(10) – р. 3627-45 .

Azimzadeh J, Bornens M. / Structure and duplication of the centrosome. // J Cell Sci. - 2007 p. 2139-42 .

Barros TP, Kinoshita K, Hyman AA, Raff JW. / Aurora A activates D-TACC-Msps complexes exclusively at centrosomes to stabilize centrosomal microtubules. // J Cell Biol. – 2005 - 170(7) – р .

1039-46 .

Bartolini F, Gundersen GG. / Generation of noncentrosomal microtubule arrays. // J Cell Sci p. 4155-63 .

Baschieri F, Confalonieri S, Bertalot G, Di Fiore PP, Dietmaier W, Leist M, Crespo P, Macara IG, Farhan H. / Spatial control of Cdc42 signalling by a GM130-RasGRF complex regulates polarity and tumorigenesis. // Nat Commun. - 2014 – 11 - 5:4839 .

Beach JR, Licate LS, Crish JF, Egelhoff TT. / Analysis of the role of Ser1/Ser2/Thr9 phosphorylation on myosin II assembly and function in live cells. // BMC Cell Biol. - 2011 - 12 - 52 .

Bernards A. / GAPs galore! A survey of putative Ras superfamily GTPase activating proteins in man and Drosophila. // Biochim Biophys Acta. - 2003 - 1603(2) – p. 47-82 .

Bhattacharya M, Babwah AV, Ferguson SS. / Small GTP-binding protein-coupled receptors. // Biochem Soc Trans. - 2004 - 32(6) – p. 1040-4 .

Bornens M. / Centrosome composition and microtubule anchoring mechanisms. // Curr Opin Cell Biol. – 2002 - 14(1) – p. 25-34 .

Boureux A, Vignal E, Faure S, Fort P. / Evolution of the Rho family of ras-like GTPases in eukaryotes. // Mol Biol Evol. – 2007 - 24(1) – р. 203-16 .

Blanchoin L, Boujemaa-Paterski R, Sykes C, Plastino J. / Actin dynamics, architecture, and mechanics in cell motility. // Physiol Rev. - 2014 - 94(1) – p. 235-63 .

Bratman SV, Chang F. / Mechanisms for maintaining microtubule bundles. // Trends Cell Biol. – 2008 - 18(12) – p. 580-6 .

Brown DL, Heimann K, Lock J, Kjer-Nielsen L, van Vliet C, Stow JL, Gleeson PA. / The GRIP domain is a specific targeting sequence for a population of trans-Golgi network derived tubulovesicular carriers. // Traffic. - 2001 - 2(5) – p. 336-44 .

Brownhill K, Wood L, Allan V. / Molecular motors and the Golgi complex: staying put and moving through. // Semin Cell Dev Biol. – 2009 - 20(7) – p. 784-92 .

Burkhardt JK, Echeverri CJ, Nilsson T, Vallee RB. Overexpression of the dynamitin (p50) subunit of the dynactin complex disrupts dynein-dependent maintenance of membrane organelle distribution. // J Cell Biol. - 1997 - 139(2) – p. 469-84 .

Bulinski J.C., Gundersen G.G. / Stabilization of post-translational modification of microtubules during cellular morphogenesis. // Bioessays. – 1991 - 13(6) – p. 285-93 .

Burakov A, Kovalenko O, Semenova I, Zhapparova O, Nadezhdina E, Rodionov V. / Cytoplasmic dynein is involved in the retention of microtubules at the centrosome in interphase cells .

// Traffic. – 2008 - 9(4) – p. 472-80 .

Burakov AV, Zhapparova ON, Kovalenko OV, Zinovkina LA, Potekhina ES, Shanina NA, Weiss DG, Kuznetsov SA, Nadezhdina ES. / Ste20-related protein kinase LOSK (SLK) controls microtubule radial array in interphase. // Mol Biol Cell - 2008 - 19(5) – р. 1952-61 .

Bustelo XR, Sauzeau V, Berenjeno IM. / GTP-binding proteins of the Rho/Rac family:

regulation, effectors and functions in vivo. // Bioessays. - 2007 - 29(4) – р. 356-70 .

Burguete AS, Fenn TD, Brunger AT, Pfeffer SR. / Rab and Arl GTPase family members cooperate in the localization of the golgin GCC185. // Cell. - 2008 - 132(2) – p. 286-98 .

Carlier MF. / Control of actin dynamics. // Curr Opin Cell Biol – 1998 – 10 – p. 45-51 .

Casenghi M, Meraldi P, Weinhart U, Duncan PI, Krner R, Nigg EA. / Polo-like kinase 1 regulates Nlp, a centrosome protein involved in microtubule nucleation. // Dev Cell. - 2003 - 5(1) – p .

113-25 .

Casenghi M, Barr FA, Nigg EA. / Phosphorylation of Nlp by Plk1 negatively regulates its dynein-dynactin-dependent targeting to the centrosome. // J Cell Sci. - 2005 - 118(21) – p. 5101-8 .

Chaar Z, O'reilly P, Gelman I, Sabourin LA. / v-Src-dependent down-regulation of the Ste20-like kinase SLK by casein kinase II. // J Biol Chem. - 2006 - 281(38) р. 28193-9 .

Chabin-Brion K, Marceiller J, Perez F, Settegrana C, Drechou A, Durand G, Pos C. / The Golgi complex is a microtubule-organizing organelle. // Mol Biol Cell. - 2001 - 12(7) – p. 2047-60 .

Chang W, Antoku S, stlund C, Worman HJ, Gundersen GG. / Linker of nucleoskeleton and cytoskeleton (LINC) complex-mediated actin-dependent nuclear positioning orients centrosomes in migrating myoblasts. // Nucleus. - 2015 - 6(1) – p. 77-88 .

Cheney RE, O'Shea MK, Heuser JE, Coelho MV, Wolenski JS, Espreafico EM, Forscher P, Larson RE, Mooseker MS. / Brain myosin-V is a two-headed unconventional myosin with motor activity. // Cell. - 1993 - 75(1) – p. 13-23 .

Chowdhury S, Ketcham SA, Schroer TA, Lander GC. / Structural organization of the dyneindynactin complex bound to microtubules. // Nat Struct Mol Biol. – 2015 - Mar 9. doi:

10.1038/nsmb.2996. [Epub ahead of print] Cole NB, Sciaky N, Marotta A, Song J, Lippincott-Schwartz J. / Golgi dispersal during microtubule disruption: regeneration of Golgi stacks at peripheral endoplasmic reticulum exit sites. // Mol Biol Cell. – 1996 - 7(4) – p. 631-50 .

Conde C, Cceres A. / Microtubule assembly, organization and dynamics in axons and dendrites .

// Nat Rev Neurosci. - 2009 - 10(5) – p. 319-32 .

Cook TA, Nagasaki T, Gundersen GG Cook TA. / RhoA guanosine triphosphatase mediates the selective stabilization of microtubules induced by lysophosphatidic acid. // J Cell Biol. - 1998 - 141(1)

– p. 175-85 .

Culver-Hanlon TL, Lex SA, Stephens AD, Quintyne NJ, King SJ. / A microtubule-binding domain in dynactin increases dynein processivity by skating along microtubules. Nat Cell Biol. - 2006

- 8(3) – р. 264-70 .

Cybulsky AV, Takano T, Papillon J, Hao W, Mancini A, Di Battista JA, Cybulsky MI. / The 3'untranslated region of the Ste20-like kinase SLK regulates SLK expression. // Am J Physiol Renal Physiol.

- 2007 - 292(2):

- p. 845-52 Dammermann A, Merdes A. / Assembly of centrosomal proteins and microtubule organization depends on PCM-1. // J Cell Biol. – 2002 - 159(2) – p. 255-66 .

Dan I, Watanabe NM, Kusumi A. / The Ste20 group kinases as regulators of MAP kinase cascades. // Trends Cell Biol. - 2001 11(5) – р. 220-30 .

Delarosa S., Guillemette J., Papillon J., Han Y., Kristof A., and Cybulsky A. / Activity of the Ste20-like kinase, SLK, is enhanced by homodimerization. // Am J Physiol Renal Physiol. – 2011 р. 554–564 .

Delaval B, Doxsey SJ. / Pericentrin in cellular function and disease. // J Cell Biol. – 2010 p. 181–190 .

Delgehyr N, Sillibourne J, Bornens M. / Microtubule nucleation and anchoring at the centrosome are independent processes linked by ninein function. J Cell Sci. - 2005 - 118(8) – р. 1565-75 .

Delpire E. / The mammalian family of sterile 20p-like protein kinases. // Pflgers Arch. – 2009 р. 953-67 .

Diviani D, Langeberg LK, Doxsey SJ, Scott JD. / Pericentrin anchors protein kinase A at the centrosome through a newly identified RII-binding domain. // Curr Biol. - 2000 - 10(7) – p. 417-20 .

Drabek K, van Ham M, Stepanova T, Draegestein K, van Horssen R, Sayas CL, Akhmanova A, Ten Hagen T, Smits R, Fodde R, Grosveld F, Galjart N. / Role of CLASP2 in microtubule stabilization and the regulation of persistent motility. // Curr Biol. – 2006 - 16(22) – p. 2259-64 .

Dransart E, Olofsson B, Cherfils J. / RhoGDIs revisited: novel roles in Rho regulation. // Traffic. - 2005 - 6(11) – p. 957-66 .

Duellberg C, Trokter M, Jha R, Sen I, Steinmetz MO, Surrey T. / Reconstitution of a hierarchical +TIP interaction network controlling microtubule end tracking of dynein. Nat Cell Biol. - 2014 - 16(8)

– р. 804-11 .

Eckes B, Colucci-Guyon E, Smola H, Nodder S, Babinet C, Krieg T, Martin P. / Impaired wound healing in embryonic and adult mice lacking vimentin. // J Cell Sci. - 2000 - 113(13) – p. 2455-62 .

Efimov A, Kharitonov A, Efimova N, Loncarek J, Miller PM, Andreyeva N, Gleeson P, Galjart N, Maia AR, McLeod IX, Yates JR 3rd, Maiato H, Khodjakov A, Akhmanova A, Kaverina I. / Asymmetric CLASP-dependent nucleation of noncentrosomal microtubules at the trans-Golgi network. // Dev Cell. – 2007 - 12(6) – p. 917-30 .

Ellerbroek SM, Wennerberg K, Burridge K. / Serine phosphorylation negatively regulates RhoA in vivo. // J Biol Chem – 2003 – 278(21) – p. 19023-31 .

Etienne-Manneville S, Hall A. / Rho GTPases in cell biology. // Nature. – 2002 - 420(6916) – p .

629-35 .

Euteneuer U, Schliwa M. / Persistent, directional motility of cells and cytoplasmic fragments in the absence of microtubules. // Nature. - 1984 - 310(5972) – р. 58-61 .

Fogh BS, Multhaupt HA, Couchman JR. / Protein kinase C, focal adhesions and the regulation of cell migration. // J Histochem Cytochem. - 2014 - 62(3) – p. 172-84 .

–  –  –

Fumoto K, Hoogenraad CC, Kikuchi A. / GSK-3beta-regulated interaction of BICD with dynein is involved in microtubule anchorage at centrosome. // EMBO J. - 2006 - 25(24) – p. 5670-82 .

Galjart N. / CLIPs and CLASPs and cellular dynamics. // Nat Rev Mol Cell Biol. - 2005 - 6(6) – p. 487-98 .

Gao, F. The Roles of GSK-3 and APC in Cytoplasmic Dynein Regulation: dissertation for the degree of Doctor of Philosophy in Biological Sciences. // Gao Feng. – South Carolina, 2014. – 138 p .

Retrieved from http://scholarcommons.sc.edu/etd/2947 .

Ghosh PM, Ghosh-Choudhury N, Moyer ML, Mott GE, Thomas CA, Foster BA, Greenberg NM, Kreisberg JI. / Role of RhoA activation in the growth and morphology of a murine prostate tumor cell line. // Oncogene – 1999 – 18(28) – p. 4120-30 .

Gillingham AK, Munro S. / The PACT domain, a conserved centrosomal targeting motif in the coiled-coil proteins AKAP450 and pericentrin. // EMBO Rep. - 2000 - 1(6) – p. 524-9 .

Glick BS. / Organization of the Golgi apparatus. // Curr Opin Cell Biol. - 2000 - 12(4) – p. 450Gomes ER, Jani S, Gundersen GG. / Nuclear movement regulated by Cdc42, MRCK, myosin, and actin flow establishes MTOC polarization in migrating cells. // Cell. - 2005 - 121(3 – p.451-63 .

Goto H, Kosako H, Tanabe K, Yanagida M, Sakurai M, Amano M, Kaibuchi K, Inagaki M. / Phosphorylation of vimentin by Rho-associated kinase at a unique amino-terminal site that is specifically phosphorylated during cytokinesis. // J Biol Chem. – 1998 - 273(19) – p. 11728-36 .

Graham FL, Smiley J, Russell WC, Nairn R. / Characteristics of a human сell line transformed by DNA from human adenovirus type 5. // J Gen Virol. – 1977 - 36(1) – р. 59-74 .

Grigoriev I, Borisy G, Vorobjev I. / Regulation of microtubule dynamics in 3T3 fibroblasts by Rho family GTPases. // Cell Motil Cytoskeleton. - 2006 - 63(1) – p. 29-40 .

Guilluy C, Rolli-Derkinderen M, Loufrani L, Bourg A, Henrion D, Sabourin L, Loirand G, Pacaud P. / Ste20-related kinase SLK phosphorylates Ser188 of RhoA to induce vasodilation in response to angiotensin II Type 2 receptor activation. // Circ Res. - 2008 - 102(10) – p. 1265-74 .

Hakem A, Sanchez-Sweatman O, You-Ten A, Duncan G, Wakeham A, Khokha R, Mak TW. / RhoC is dispensable for embryogenesis and tumor initiation but essential for metastasis. // Genes Dev. - 2005 - 19(17) – p. 1974-9 .

Hall A. / Rho GTPases and the control of cell behaviour. Biochem Soc Trans. – 2005- 33(5) – р .

891-5 .

Hao W, Takano T, Guillemette J, Papillon J, Ren G, Cybulsky AV. / Induction of apoptosis by the Ste20-like kinase SLK, a germinal center kinase that activates apoptosis signal-regulating kinase and p38. // J Biol Chem. - 2006 - 281(6) р. 3075-84 .

Heasman SJ, Ridley AJ. / Mammalian Rho GTPases: new insights into their functions from in vivo studies. // Nat Rev Mol Cell Biol. - 2008 - 9(9) – p. 690-701 .

–  –  –

Herrmann H, Br H, Kreplak L, Strelkov SV, Aebi U. / Intermediate filaments: from cell architecture to nanomechanics. // Nat Rev Mol Cell Biol. - 2007 - 8(7) – p. 562-73 .

Hopps HE, Bernheim BC, Nisalak A, Tjio JH, Smadel JE. / Biologic characteristics of a continious kidney cell line derived from the African green monkey. J Immunol. - 1963 – 91 – p. 416Huang P, Senga T, Hamaguchi M. / A novel role of phospho-beta-catenin in microtubule regrowth at centrosome. // Oncogene. - 2007 - 26(30) – p. 4357-71 .

Inoue A, Saito J, Ikebe R, Ikebe M. / Myosin IXb is a single-headed minus-end-directed processive motor. // Nat Cell Biol. - 2002 - 4(4) – p. 302-6 .

Ishikawa K, Saiki S, Furuya N, Yamada D, Imamichi Y, Li Y, Kawajiri S, Sasaki H, Koike M, Tsuboi Y, Hattori N./ P150glued-associated disorders are caused by activation of intrinsic apoptotic pathway. // PLoS One. - 2014 - 9(4) - e94645 .

Itoh S, Kameda Y, Yamada E, Tsujikawa K, Mimura T, Kohama Y. / Molecular cloning and characterization of a novel putative STE20-like kinase in guinea pigs. // Arch Biochem Biophys – 1997 - 340(2) – р. 201-7 .

Izumi N, Fumoto K, Izumi S, Kikuchi A. / GSK-3beta regulates proper mitotic spindle formation in cooperation with a component of the gamma-tubulin ring complex, GCP5. // J Biol Chem - 2008 p. 12981-91 .

Jin H, White SR, Shida T, Schulz S, Aguiar M, Gygi SP, Bazan JF, Nachury MV. / The conserved Bardet-Biedl syndrome proteins assemble a coat that traffics membrane proteins to cilia. // Cell. - 2010 Jun - 141(7) – p. 1208-19 .

Jing J, Junutula JR, Wu C, Burden J, Matern H, Peden AA, Prekeris R. / FIP1/RCP binding to Golgin-97 regulates retrograde transport from recycling endosomes to the trans-Golgi network. // Mol Biol Cell. - 2010 - 21(17) – p. 3041-53 .

Katz P, Whalen G, Kehrl JH. / Differential expression of a novel protein kinase in human B lymphocytes. // J Biol Chem. – 1997 - 269(24) – p. 16802-9 .

Keliang Xu, Patricia M. Schwarz, and Richard F. Luduea. / Interaction of Nocodazole With Tubulin Isotypes. // Drug Dev Res. – 2002 – 55 – p. 91-96 .

King SJ, Schroer TA. / Dynactin increases the processivity of the cytoplasmic dynein motor. // Nat Cell Biol. - 2000 - 2(1) – р. 20-4 .

Kim HS, Takahashi M, Matsuo K, Ono Y. / Recruitment of CG-NAP to the Golgi apparatus through interaction with dynein-dynactin complex. // Genes Cells. - 2007 - 12(3) – p. 421Kim, J. C., Badano, J. L., Sibold, S., Esmail, M. A., Hill, J., Hoskins, B. E., Leitch, C. C., Venner, K., Ansley, S. J., Ross, A. J. / The Bardet-Biedl protein BBS4 targets cargo to the pericentriolar region and is required for microtubule anchoring and cell cycle progression. // Nat .

Genet. – 2004 – 36(5) – p. 462-470 .

Kim J, Krishnaswami SR, Gleeson JG. / CEP290 interacts with the centriolar satellite component PCM-1 and is required for Rab8 localization to the primary cilium. // Hum Mol Genet. - 2008 - 17(23)

– p. 3796-805 .

Kim JH, Wang A, Conti MA, Adelstein RS. / Nonmuscle myosin II is required for internalization of the epidermal growth factor receptor and modulation of downstream signaling. // J Biol Chem. – 2012 - 287(33) - p. 27345-58 .

Kim S, Lee K, Rhee K. / NEK7 is a centrosomal kinase critical for microtubule nucleation. // Biochem Biophys Res Commun. - 2007 - 360(1) – p.56-62 .

Kitagawa D, Vakonakis I, Olieric N, Hilbert M, Keller D, Olieric V, Bortfeld M, Erat MC, Flckiger I, Gnczy P, Steinmetz MO. / Structural basis of the 9-fold symmetry of centrioles. // Cell. - 2011 - 144(3) – p. 364-75 .

Klausner RD, Donaldson JG, Lippincott-Schwartz J. / Brefeldin A: insights into the control of membrane traffic and organelle structure. // J Cell Biol. - 1992 - 116(5) – p. 1071-80 .

Kodani A, Stterlin C. / The Golgi protein GM130 regulates centrosome morphology and function. // Mol Biol Cell. - 2008 - 19(2) – p. 745-53 .

Kodani A, Tonthat V, Wu B, Stterlin C. / Par6 alpha interacts with the dynactin subunit p150Glued and is a critical regulator of centrosomal protein recruitment. // Mol Biol Cell. - 2010 р. 3376-85 .

Kodani A, Stterlin C. / A new function for an old organelle: microtubule nucleation at the Golgi apparatus. // EMBO J. - 2009 - 28(8) – p. 995-6 .

Krendel M, Zenke FT, Bokoch GM. / Nucleotide exchange factor GEF-H1 mediates cross-talk between microtubules and the actin cytoskeleton. // Nat Cell Biol. - 2002 - 4(4) – р. 294-301 .

Kubo A, Sasaki H, Yuba-Kubo A, Tsukita S, Shiina N. / Centriolar satellites: molecular characterization, ATP-dependent movement toward centrioles and possible involvement in ciliogenesis. // J Cell Biol. – 1999 - 147(5) – p. 969-80 .

Kueh HY, Mitchison TJ. / Structural plasticity in actin and tubulin polymer dynamics. // Science .

- 2009 - 325(5943) – p. 960-3 .

Lang P, Gesbert F, Delespine-Carmagnat M, Stancou R, Pouchelet M, Bertoglio J. / Protein kinase A phosphorylation of RhoA mediates the morphological and functional effects of cyclic AMP in cytotoxic lymphocytes. // EMBO J. – 1996 - 15(3) – p. 510-9 .

Lazarus JE, Moughamian AJ, Tokito MK, Holzbaur EL. / Dynactin subunit p150(Glued) is a neuron-specific anti-catastrophe factor. PLoS Biol. – 2013 - 11(7) - e1001611 .

Lansbergen G, Grigoriev I, Mimori-Kiyosue Y, Ohtsuka T, Higa S, Kitajima I, Demmers J, Galjart N, Houtsmuller AB, Grosveld F, Akhmanova A. / CLASPs attach microtubule plus ends to the cell cortex through a complex with LL5beta. // Dev Cell. - 2006 - 11(1) - 21-32 .

Lawrence CJ, Dawe RK, Christie KR, Cleveland DW, Dawson SC, Endow SA, Goldstein LS, Goodson HV, Hirokawa N, Howard J, Malmberg RL, McIntosh JR, Miki H, Mitchison TJ, Okada Y, Reddy AS, Saxton WM, Schliwa M, Scholey JM, Vale RD, Walczak CE, Wordeman L. / A standardized kinesin nomenclature. // J Cell Biol. - 2004 - 167(1) – p. 19-22 .

Leberer E, Thomas DY, Whiteway M. / Pheromone signalling and polarized morphogenesis in yeast. // Curr Opin Genet Dev – 1997 – 7(1) –p. 59-66 .

Lewy GD, Ryan GA, Read ML, Fong JC, Poole V, Seed RI, Sharma N, Smith VE, Kwan PP, Stewart SL, Bacon A, Warfield A, Franklyn JA, McCabe CJ, Boelaert K. / Regulation of pituitary tumor transforming gene (PTTG) expression and phosphorylation in thyroid cells. // Endocrinology. р. 4408-22 .

Li F, Higgs HN. / The mouse Formin mDia1 is a potent actin nucleation factor regulated by autoinhibition. // Curr Biol. - 2003 - 13(15) – p. 1335-40 .

Li J, Lee WL, Cooper JA. / NudEL targets dynein to microtubule ends through LIS1. // Nat Cell Biol. - 2005 - 7(7) – p. 686-90 .

Li, W., Yu, J. C., Shin, D. Y., and Pierce, J. H. / Characterization of a protein kinase C-delta (PKC-delta) ATP binding mutant. An inactive enzyme that competitively inhibits wild type PKC-delta enzymatic activity. // J. Biol. Chem. – 1995 – 270 – p.8311–8318 .

Lin YC, Chiang TC, Liu YT, Tsai YT, Jang LT, Lee FJ. / ARL4A acts with GCC185 to modulate Golgi complex organization. // J Cell Sci. - 2011 - 124(23) - p. 4014-26 .

Liu AX, Rane N, Liu JP, Prendergast GC. / RhoB is dispensable for mouse development, but it modifies susceptibility to tumor formation as well as cell adhesion and growth factor signaling in transformed cells. // Mol Cell Biol. – 2001 - 21(20) – p. 6906-12 .

Liu C, Li Y, Semenov M, Han C, Baeg GH, Tan Y, Zhang Z, Lin X, He X. / Control of betacatenin phosphorylation/degradation by a dual-kinase mechanism. // Cell. - 2002 - 108(6) – p. 837-47 .

Liu M, Bi F, Zhou X, Zheng Y. / Rho GTPase regulation by miRNAs and covalent modifications. // Trends Cell Biol. - 2012 - 22(7) – p. 365-73 .

Lomakin AJ, Semenova I, Zaliapin I, Kraikivski P, Nadezhdina E, Slepchenko BM, Akhmanova A, Rodionov V. / CLIP-170-dependent capture of membrane organelles by microtubules initiates minus-end directed transport. // Dev Cell. - 2009 - 17(3) – p. 323-33 .

Loncarek J, Hergert P, Magidson V, Khodjakov A. / Control of daughter centriole formation by the pericentriolar material. Nat Cell Biol. - 2008 - 10(3) – p. 322-8 .

Lders J, Patel UK, Stearns T. / GCP-WD is a gamma-tubulin targeting factor required for centrosomal and chromatin-mediated microtubule nucleation. // Nat Cell Biol. - 2006 - 8(2) – p. 137Luduena RF, Roach MC. / Tubulin sulfhydryl groups as probes and targets for antimitotic and antimicrotubule agents. // Pharmacol Ther. – 1991 - 49(1-2) - p. 133-52 .

Luke MR, Kjer-Nielsen L, Brown DL, Stow JL, Gleeson PA. / GRIP domain-mediated targeting of two new coiled-coil proteins, GCC88 and GCC185, to subcompartments of the trans-Golgi network .

// J Biol Chem. - 2003 - 278(6) – p. 4216-26 .

Luhovy A.Y., Jaberi A., Papillon J., Guillemette J. Cybulsky A.V. / Regulation of the Ste20-like kinase, SLK: involvement of activation segment phosphorylation. J Biol Chem, - 2012 – 287(8) – p .

5446-5458 .

Machacek M, Hodgson L, Welch C, Elliott H, Pertz O, Nalbant P, Abell A, Johnson GL, Hahn KM, Danuser G. / Coordination of Rho GTPase activities during cell protrusion. // Nature. - 2009 p. 99-103 .

Machicoane M, de Frutos C, Fink J, Rocancourt M, Lombardi Y, Garel S, Piel M, Echard A. / SLK-dependent activation of ERMs controls LGN–NuMA localization and spindle orientation. // J .

Cell Biol. – 2014 – 205(6) – p. 791–799 .

Madaule P, Eda M, Watanabe N, Fujisawa K, Matsuoka T, Bito H, Ishizaki T, Narumiya S. / Role of citron kinase as a target of the small GTPase Rho in cytokinesis. // Nature. - 1998 - 394(6692)

– р. 491-4 .

Madaule P, Axel R. / A novel ras-related gene family. // Cell. - 1985 - 41(1) – p. 31-40 .

Magdalena J, Millard TH, Machesky LM. / Microtubule involvement in NIH 3T3 Golgi and MTOC polarity establishment. // J Cell Sci. – 2003 - 116(4) – р. 743-56 .

Malikov V, Kashina A, Rodionov V. / Cytoplasmic dynein nucleates microtubules to organize them into radial arrays in vivo. // Mol Biol Cell. - 2004 - 15(6) – p. 2742-9 .

Martys JL, Ho CL, Liem RK, Gundersen GG. / Intermediate filaments in motion: observations of intermediate filaments in cells using green fluorescent protein-vimentin. // Mol Biol Cell. - 1999 p. 1289-95 .

Marx A, Mller J, Mandelkow E. / The structure of microtubule motor proteins. // Adv Protein Chem. – 2005 – 71 – p. 299-344 .

McConville MJ, Ilgoutz SC, Teasdale RD, Foth BJ, Matthews A, Mullin KA, Gleeson PA. / Targeting of the GRIP domain to the trans-Golgi network is conserved from protists to animals. // Eur J Cell Biol. - 2002 - 81(9) – p. 485-95 .

Meiri D, Marshall CB, Greeve MA, Kim B, Balan M, Suarez F, Bakal C, Wu C, Larose J, Fine N, Ikura M, Rottapel R. / Mechanistic insight into the microtubule and actin cytoskeleton coupling through dynein-dependent RhoGEF inhibition. // Mol Cell. - 2012 - 45(5) – p.642-55 .



Pages:   || 2 |



Похожие работы:

«КОНФЕРЕНЦИИ "Газоочистка 2005" испытание электричеством выдержала России предстоит усовершенствовать подходы к решению экологических задач и внедрить ряд новых технологий Петр Степаненко К онференция специалистов по очистке газов от загрязнений и применению серы, организо ванная ОАО "Гипрогазоочист ка", проходила с 25 по 27 мая...»

«Министерство образования и науки Российской Федерации САРАТОВСКИЙ НАЦИОНАЛЬНЫЙ ИССЛЕДОВАТЕЛЬСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ ИМЕНИ Н.Г. ЧЕРНЫШЕВСКОГО Кафедра общей геологии и полезных ископаемых "Оценка загрязнения грунтовых вод и почво-грунтов нефтепродуктами в зонах влияния автозаправочных ком...»

«Отчет по 1 этапу договора на выполнение научно-исследовательских работ по теме "Разработка и публикация Стратегии сохранения и восстановления сайгака в России и Регионального плана действия по сохранению и восстановлению сайгака в Республике Калмыкия" В соответствии с календарным планом по 1 этапу...»

«Министерство сельского хозяйства Республики Казахстан Комитет лесного хозяйства и животного мира Иле-Алатауский государственный национальный природный парк Труды Иле-АлАТАуского госудАрсТВеННого НАцИоНАльНого...»

«УДК: 54Ш 539.2 каэоадвв Г.Ш. Аскарова, Н.Р. Мажренова ВЛИЯНИЕ ЭЛЕКТРОННО-ЛУЧЕВОГО ВОЗДЕЙСТВИЯ НА ПРОЦЕССЫ ИЗВЛЕЧЕНИЯ МЫШЬЯКА 113 ЗОЛОТОСОДЕРЖАЩИХ РУД. Основными загрязнителями биосферы являются токсические вещества неор иической природы цианиды, арсины, фосфины, силаны и их производные. Инт относ развитие современных тех...»

«United Nations Development Program – Global Environmental Facility (UNDP-GEF) Black Sea Environmental Programme Black Sea Ecosystems Recovery Project Т.А. Беленко Экологические проблемы Чёрного и Азовского морей – естественнонаучны...»

«Фармацевтический рынок РОССИИ Выпуск: октябрь 2014 розничный аудит фармацевтического рынка РФ – октябрь 2014 события фармацевтического рынка – ноябрь 2014 Информация основана на данных розничного аудита фармацевтического рынка РФ DSM Group, система менеджмента качества которого соотве...»

«Самарская Лука. 2007 – Т. 16, № 4(22) – С. 762-774. © 2007 А.В. Елизаров* СТЕПЬ СТАРОГО СТАВРОПОЛЯ: ОПЫТ КОНСЕРВАЦИОННОГО АНАЛИЗА ТРАВЯНОЙ ЭКОСИСТЕМЫ НА ГОРОДСКОЙ ТЕРРИТОРИИ. Приводятся итоги...»

«1. Вопрос: "Оформление стелы АЗС" Согласно письму ФАС России от 30.05.2016 N АК/36040/16 "Об отнесении информации к рекламе", автозаправочные станции являются объектами сервиса автомобильных дорог и информирование водителей о приближении к ним путем установления стелы или информационного табло со сведени...»

«Известия Челябинского научного центра, вып. 3 (29), 2005 ХИМИЯ И БИОЭКОЛОГИЯ УДК 546.654–3:541.18 МОДЕЛИРОВАНИЕ ПРОЦЕССА ГИДРАТАЦИИ ОКСИГИДРАТОВ ГАДОЛИНИЯ И ИТТЕРБИЯ Ю.И . Сухарев, М.Ю. Белканова e–mail: wik22@inbox.ru Южно–Уральский государственный университет, г. Челябинск, Ро...»

«СО РАН и 70-летию образования Красноярского края, 1-3 сентября 2004 г., г. Красноярск. Красноярск, 2004. С. 131 133. Денисов, Н.И . Деревянистые лианы российского Дальнего Востока. [Текст] / Н.И. Денисов. Владивосток: Дальнаука,...»

«Ла б о р ато р н ы е животные 2018 №3 дЛя научных иссЛедований https://doi.org/10.29296/2618723X-2018-03-01 Активация эндокринной системы семенников мышей линии С57BL/6J в ответ на сексуальный...»

«BY0200199 целиком (85-95 %) находится в ионной форме (Глаголева, 1959). Нами установлено, что удельна(га1тивностьстронцйя-90 в мокрых выпадениях над акваторией озера сильно варьирует ( от 15,5 до 314 Бк/м3) и связана с метеорологическими условиями, т.е. с мощностью и продолжительностью выпадений (Душэускене-Дуж, Ясюленис, 1...»

«Межрегиональная конференция с международным участием ПЕРЕХОД К ЗЕЛЕНОЙ ЭКОНОМИКЕ И УСТОЙЧИВОМУ РАЗВИТИЮ В АЛТАЙСКОМ КРАЕ: ПЕРСПЕКТИВЫ, МЕХАНИЗМЫ, КЛЮЧЕВЫЕ НАПРАВЛЕНИЯ 22-24.10.2015, Барнаул Вызовы времени и предпосылки формирования рынка экологических услуг в Алт...»

«Всемирная организация здравоохранения ИСПОЛНИТЕЛЬНЫЙ КОМИТЕТ EB120/13 Сто двадцатая сессия 30 ноября 2006 г. Пункт 4.12 предварительной повестки дня Проекты резолюций, перенесенные с Пятьдесят девятой сессии В...»

«ЦЕПКОВ ЕВГЕНИЙ ВЛАДИМИРОВИЧ УГОЛОВНО ПРАВОВАЯ ХАРАКТЕРИСТИКА ПРИСВОЕНИЯ ИЛИ РАСТРАТЫ (ст. 160 УК РФ) направления 40.03.01. – "Юриспруденция" юридического факультета Автореферат бакалаврской работы Саратов 2016 Работа выполнена на кафедре...»

«Самарская Лука: проблемы региональной и глобальной экологии. 2011. – Т. 20, № 2. – С. 31-43. УДК 598.1(091)(470.53) ОБ ИСТОРИИ ИЗУЧЕНИЯ ГЕРПЕТОФАУНЫ ПЕРМСКОГО КРАЯ 2011 А.Г. Бакиев, Н.А. Четанов* Институт экологии Волжского бассейна Р...»

«ЭКОЛОГИЧЕСКИЕ И ГЕНЕТИЧЕСКИЕ ХАРАКТЕРИСТИКИ ДОМОВЫХ И КУРГАНЧИКОВЫХ МЫШЕЙ (MUS MUSCULUS S. STR. И MUS SPICILEGUS PETENYI), ОПРЕДЕЛИВШИЕ ИХ ОТНОСИТЕЛЬНЫЙ ЭВОЛЮЦИОННЫЙ УСПЕХ И АРЕАЛЫ А.Н. Милишников Институт проб...»

«Номер: KZ67VDC00051827 Дата: 16.08.2016 ПАВЛОДАР ОБЛЫСЫНЫ КІМДІГІ АКИМАТ ПАВЛОДАРСКОЙ ОБЛАСТИ “ПАВЛОДАР ОБЛЫСЫНЫ ГОСУДАРСТВЕННОЕ УЧРЕЖДЕНИЕ ЖЕР ОЙНАУЫН ПАЙДАЛАНУ, ОРШААН “УПРАВЛЕНИЕ НЕДРОПОЛЬЗОВАНИЯ, ОРТА ЖНЕ СУ РЕСУРСТА...»

«ЧТЕНИЯ ПАМЯТИ ВЛАДИМИРА ЯКОВЛЕВИЧА ЛЕВАНИДОВА V. Y. Levanidov's Biennial Memorial Meetings Вып. 1 ФАУНА ХИРОНОМИД ПОДСЕМЕЙСТВА ORTHOCLADIINAE (DIPTERA, CHIRONOMIDAE) ОСТРОВА ВРАНГЕЛЯ Е.А. Макарченко, М.А. Макарченко Биолого-почвенный институт ДВО РА...»

«ОСНОВНАЯ ПРОФЕССИОНАЛЬНАЯ ОБРАЗОВАТЕЛЬНАЯ ПРОГРАММА ПОДГОТОВКИ БАКАЛАВРА по направлению 06.03.01 Биология профиль Общая биология Б. 1.13.3 Модуль Зоологический. Основы протистологии Приложение 1 Типовые задания для проведения процедур оценивания результато...»




 
2019 www.mash.dobrota.biz - «Бесплатная электронная библиотека - онлайн публикации»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.