WWW.MASH.DOBROTA.BIZ
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - онлайн публикации
 

Pages:     | 1 || 3 |

«ИМ. А.Н. СЕВЕРЦОВА РОССИЙСКОЙ АКАДЕМИИ НАУК ЦЕНТР ПАРАЗИТОЛОГИИ Труды, том L Основаны в 1948 году БИОРАЗНООБРАЗИЕ ПАРАЗИТОВ Товарищество научных изданий КМК Москва 2018 УДК 576.8 ББК 28.083 ...»

-- [ Страница 2 ] --

В нашем исследовании наблюдаются две тенденции изменения фракционного состава белков инкубационной среды, содержащей сыворотку крови омуля, после инкубации плероцеркоидов: появление одних фракций и исчезновение других. Через 3ч. появляется высокомолекулярная фракция с ММ 193 кДа, которая сохраняется через 12 и 24 ч. Интересно то, что в организме плероцеркоидов через 12ч. после начала инкубации также наблюдается появление новой фракции ММ 189 кДа (рис. 1б). Поэтому можно предположить, что плероцеркоиды в ответ на погружение в инкубационную среду реагируют выработкой и секрецией белков ММ ~ 190 кДа. Ранее было установлено, что у плероцеркоидов D. dendriticum при инкубации в среде, содержащей сыворотку крови омуля, максимум секреции на поверхности тела достигается через 6–12 ч после начала инкубации (Kutyrev et al., 2017). Кроме того, настоящими исследованиями показано, что через 24ч. после начала инкубации в инкубационной среде обнаруживается фракция белков ММ 88 кДа). В то же время, на электрофореграмме белков плероцеркоидов D. dendriticum через 24 ч. после инкубации исчезает фракция ММ 80 кДа. Можно предположить, что именно через 24 ч. происходит интенсивная секреция данной фракции из организма плероцеркоидов в инкубационную среду .

Таким образом, наши исследования выявили изменения фракционного состава белков инкубационной среды, содержащей сыворотку крови байкальского омуля при инкубации паразитов омуля – плероцеркоидов D. dendriticum .

Обнаружено появление двух новых высокомолекулярных фракций белков и уменьшение или исчезновение двух низкомолекулярных фракций. Вполне вероятно, что появившиеся высокомолекулярные фракции белков секретируются плероцеркоидами и могут содержать белки – регуляторы иммунной системы своих хозяев. Для выяснения этого вопроса необходимо проведение дополнительного анализа с применением методов 2D-электрофореза и массспектрометрии. Данный вопрос является предметом наших дальнейших исследований .



Авторы выражают благодарность А.В. Базову (Байкальский филиал ФГБНУ Госрыбцентр) за помощь в сборе материала. Работы по пробоподготовке, электрофорезу и визуализации белков выполнены на базе ЦКП «Протеомный анализ» НИИМББ ФИЦ ФТМ .

Работа проведена в рамках выполнения темы госзадания, № госрегистрации АААА-А17-117011810039-4, и при финансовой поддержке РФФИ (грант 16-04-01213) .

Литература

Верещагин А.И., Аксёнова, О.П. Чернявская, Читалкина Т.В. Информационный сборник статистических и аналитических материалов «Заболеваемость протозоозами и гельминтозами в Российской Федерации за 2012 – 2013 гг.» / М: Федеральный центр Госсанэпиднадзора Минздрава России, 2014. 79 с .

Давыдов В.Г., Микряков В.Р. Адаптивные структуры покровов тела некоторых цестод, связанные с защитой паразитов от влияний организма хозяев // Иммунологические и биохимические аспекты взаимоотношений гельминта и хозяина. М.: Наука, 1988. С. 88–100 .

Coakley G., Maizels R.M. Buck A.H. Exosomes and other extracellular vesicles: The new communicators in parasite infections // Trends Parasitol. 2015. V. 31. P. 477–489 .

Kutyrev I.A., Biserova N.M., Olennikov D.N. et al. Prostaglandins E2 and D2 – regulators of host immunity in the model parasite Diphyllobothrium dendriticum: an immunocytochemical and biochemical study // Mol. Biochem. Parasitol. 2017. V. 212. P. 33–45 .

Kutyrev I.A., Franke F., Bьscher J. et al. In vitro effects of prostaglandin E2 on leucocytes from sticklebacks (Gasterosteus aculeatus) infected and not infected with the cestode Schistocephalus solidus // Fish Shellfish Immunol. 2014. V. 41. P. 473–481 .



ЗНАЧЕНИЕ КЛЕЩЕЙ РОДА DERMACENTOR KOCH,

1844 (ACARI, IXODIDAE) В ФОРМИРОВАНИИ

СТРУКТУРЫ ПРИРОДНЫХ ОЧАГОВ

ТРАНСМИССИВНЫХ ИНФЕКЦИЙ ЦЕНТРАЛЬНОГО

ПРЕДКАВКАЗЬЯ

Лазаренко Е. В., Ермолова Н.В .

ФКУЗ Ставропольский противочумный институт Роспотребнадзора, 355035, г. Ставрополь, ул. Советская 13-15, lazarenko-eva@mail.ru Многообразие ландшафтно-географических зон Центрального Предкавказья (полупустынная, степная, лесостепная, предгорная) и обитание многих видов иксодовых клещей создают условия циркуляции здесь трансмиссивных инфекций. В настоящее время на данной проявляет свою активность природные очаги крымской геморрагической лихорадки (КГЛ), туляремии, регистрируются случаи заболевания людей болезнью Лайма, клещевыми риккетсиозами (Тохов, 2017) .

Клещи рода Dermacentor играют большую роль в распространении и сохранении возбудителя туляремии в природе. Активность природного очага туляремии на территории Центрального Предкавказья подтверждена выделением культур возбудителя туляремии из иксодовых клещей, мелких млекопитающих и воды открытых водоемов. Исследования полевого материала показали, что наиболее частая зараженность отмечалась среди клещей D. marginatus. Этот вид в природных условиях очага является доминирующим среди иксодовых клещей и тесно связан в своем развитии с грызунами. Francisella tularensis передается клещами D. marginatus трансфазово, что обеспечивает длительное хранение возбудителя туляремии в природном очаге. Значение иксодовых клещей в поддержании очаговости туляремии ограничивается периодом, когда они паразитируют в фазах личинки и нимфы на мышевидных грызунах. С этим периодом связанно более постоянное воспроизведение и рассеивание возбудителя туляремии в популяциях грызунов. Клещи в фазе имаго, вышедшие из инфицированных нимф, несмотря на способность пожизненно сохранять в себе вирулентные бактерии туляремии, фактически утрачивают значение в поддержании циркуляции микроба туляремии в очаге .

Это объясняется тем, что для очередного кровососания имаго нападают, как правило, на крупных домашних и диких животных, а не на мелких мышевидных грызунов. Трансмиссивный тип заболевания людей составляет 2.0% (Зайцев и др., 2017) .

Естественная зараженность клещей D. marginatus и D. reticulatus риккетсиями впервые была установлена С.М. Кулагиным с соавторами в 1947. Авторы доказали передачу риккетсий через укусы естественно зараженных клещей, сохранение риккетсий в клещах по ходу метаморфоза, а также трансовариальную передачу. Риккетсии группы клещевых пятнистых лихорадок экологически связаны преимущественно с клещами рода Dermacentor. При исследовании иксодовых клещей, собранных на рассматриваемой территории, в клещах D.marginatus и D. reticulatus выявлена Rickettsia slovaca. Находки Rickettsia slovaca в клещах составили 15.3% .





В степных и полупустынных ландшафтах Центрального Предкавказья имеется активный природный очаг лихорадки Ку. Особое значение в распространении лихорадки Ку в степной зоне придают именно D.marginatus. Значение клещей в очагах Ку-риккетсиоза определяется не столько тем, что они осуществляют передачу возбудителя через укус, сколько их способностью длительно сохранять возбудителя и передавать его трансфазово и трансовариально. Клещи являются резервуарами данной инфекции в природных очагах .

Основными переносчиками и резервуаром вируса ККГЛ на территории Центрального Предкавказья является иксодовый клещ Hyalomma marginatum, но многочисленные публикации свидетельствуют о возможности его изоляции и из других видов иксодовых клещей (Карась, 1978; Н. Hoogstraal, 1979;

Варгина, Брейнингер, 1991). Согласно мнению И.В. Чумаковой с соавторами (2006) клещи D. marginatus могут служить дополнительными переносчиками в тех местах, где они являются содоминантами Н. marginatum. Согласно результатам исследований А.Ю. Газиевой (2011) в тех ландшафтах Центрального Предкавказья, где Н. marginatum не встречается или встречается в ограниченных количествах, носителями вируса ККГЛ являются клещи D. marginatus, D. reticulatus, H. punctata, I. ricinus с наибольшей значимостью первого вида. Данные, полученные В.Ф. Кондратенко (1976) в результате серии опытов, позволяют отнести клещей D. marginatus к переносчикам и длительным хранителям вируса ККГЛ в природе .

Иксодовые клещевые боррелиозы (ИКБ) – широко распространенная группа природно-очаговых инфекций, передающихся клещами рода Ixodes. На территории Центрального Предкавказья иксодовый клещевой боррелиоз стали дифференцировать начиная с 1995 г. Вопрос об участии клещей других родов, в том числе и рода Dermacentor в передаче боррелий человеку остается до настоящего времени открытым. В 2005 году С.А. Рудаковой с соавторами в результате проведенных исследований показана принципиальная возможность трансовариальной и трансфазовой передачи боррелий клещами D .

reticulatus как у спонтанно инфицированных клещей этого вида, так и в случае их экспериментального заражения штаммом боррелий. Установлено, что боррелии в организме клещей D. reticulatus сохраняются, но интенсивность размножения низка. Вероятно также, что способность к трансовариальной и трансфазовой передаче боррелий у клещей D. reticulatus свойственна лишь некоторым геновидам боррелий (близких к В. afzelii), поскольку в литературе имеются данные о невозможности такой передачи В. garinii клещами D .

silvarum и Н. concinna (Sun Y., Xu R., 2003). Таким образом, полученные С.А .

Рудаковой данные свидетельствуют о том, что клещи D. reticulatus могут вовлекаться в процесс циркуляции боррелий в природных очагах ИКБ, но не имеют сколько-нибудь существенного значения для его поддержания .

Таким образом, в природных очагах КГЛ, туляремии, лихорадки КУ Центрального Предкавказья клещи рода Dermacentor являются переносчиками и резервуарами вирусов, бактерий и риккетсий. Учитывая то, что в одном физико-географическом районе может происходить циркуляция различных возбудителей инфекций, передаваемых клещами рода Dermacentor, не исключено одновременное заражение клещей несколькими возбудителями. При последовательном питании личинок, нимф и имаго на разных хозяевах, являющихся носителями различных возбудителей, возможно заражение клеща несколькими возбудителями. Важную роль при этом играет возможность трансфазовой и трансовариальной передачи возбудителя .

Литература

Тохов Ю.М. Исследование членистоногих на естественную зараженность возбудителями природно–очаговых инфекций // Актуальные проблемы болезней, общих для человека и животных. Материалы II Всероссийской научно-практической конференции, 5–6 апреля 2017. Ставрополь, 2017. С. 189–191 .

Зайцев А.А., Гнусарева О.А., Остапович В.В., Котенёв Е.С. Заболеваемость туляремией в Ставропольском крае в период 2003–2015 гг. // Актуальные проблемы болезней, общих для человека и животных. Материалы II Всероссийской научнопрактической конференции, 5–6 апреля 2017. Ставрополь, 2017. С .

Sun Y., Xu R. Ability of Ixodes persulcatus, Haemaphysalis concinna and Dermacentor silvarum ticks to acquire and transstadially transmit Borrelia garinii // Experimental et Applied Acarology. 2003. Vol. 31 (1–2). P. 151–160 .

–  –  –

ФГБНУ «Атлантический научно-исследовательский институт рыбного хозяйства и океанографии», 236022 г. Калининград, Дмитрия Донского ул. д. 5, Россия; levonolga@yandex.ru; rodjuk@atlantniro.ru, Тел. (4012) 925471 Введение. Речная камбала Platichthys flesus (L.) – один из важнейших промысловых объектов Балтийского моря. Паразитологические исследования камбалы играют важную роль в изучении особенностей биологии данного вида рыб, трофопаразитарной системы моря, а также для оценки безопасности использования рыбы в пищевых целях. Согласно данным литературы в настоящее время у речной камбалы в юго-восточном районе Балтийского моря отмечены более 30 видов паразитов, относящихся к различным систематическим группам (Fagerholm, Kie, 1994; Mller, 1994 и др.) .

Цель данной работы – определить современное состояние фауны паразитов речной камбалы в российских водах Юго-Восточной Балтики .

Материал и методы. Методом полного паразитологического вскрытия в 2009–2017 гг. обследованы 841 экз. речной камбалы длиной 20.0–34.5 см. Сбор и фиксация паразитов выполнены по общепринятой методике (БыховскаяПавловская, 1985) .

Для характеристики частоты встречаемости виды паразитов были условно разделены на: «обычные» (О) – частота встречаемости от 20 до 100%, эта группа составляет «ядро» паразитофауны; редкие виды («Р») – частота встречаемости от 5 до 20% и очень редкие «ОР» – частота встречаемости 5% .

Для количественной оценки зараженности паразитами использован показатель – экстенсивность инвазии (ЭИ, %) – доля зараженных одним видом паразитов рыб в пробе .

Средние величины (M), ошибку средней (SE) и уровень значимости (p) рассчитывали с помощью статистического пакета STATISTICA v.6.0. Достоверность различий между средними значениями определяли с помощью критерия хи-квадрат (2). Статистическая обработка выполнена при уровне значимости р0,05 .

Результаты. В районе исследования у обследуемых рыб обнаружены 18 видов паразитов, относящиеся к 8 систематическим группам: микроспоридии (ми) – 1, олигохименофореи (о) – 1, миксоспореи (мс) – 1, моногенеи (мо)

– 1, цестоды (ц) – 4, трематоды (т) – 3, нематоды (н) – 4, скребни (с) – 3 (табл .

1). Общая зараженность рыб составляла 96.1% .

Наиболее часто встречались нематоды C. heterochrous, трематоды C .

concava mc и олигохименофореи T. jadranica .

Таблица. Видовой состав паразитов речной камбалы, локализация, информация о видах

–  –  –

Доля паразитов со сложным жизненным циклом составила 83.3%. Выявлены 2 специфичных вида: микроспоридия Glugea stephani и моногенея Gyrodactylus flexibiliradis .

Фауна паразитов речной камбалы представлена видами морского (61.1%;

m), пресноводного (33.3%; f) и солоноватоводного (5.6%; b) происхождения (табл.) .

Установлены значимо более высокие показатели ЭИ H. aduncum l. в весенний период по сравнению с летним и осенним сезонами (2=9.18; р=0.02 и 2=7.45; р=0.03, соответственно). Более низкие показатели ЭИ отмечены у P .

laevis в летний период по сравнению с весенним (2=5.9; р=0.01), и в летний, по сравнению с осенним сезоном (2=6.11; р=0.00). Выявлен статистически значимый тренд снижения ЭИ для P. laevis с 2010 г. (28.64±3.11%) до полного отсутствия данного вида в 2017 г (2=17.79; р=0.00) .

В фауне паразитов выявлены 2 патогенных для человека вида – нематода C. osculatum l. и скребень C. semerme l .

Обсуждение. Полученные результаты изучения речной камбалы в российских водах Южной Балтики позволили сравнить видовой состав ее паразитов с таковым из других районов Балтики и подтвердить данные ученых о том, что исследуемый вид обладает паразитофауной характерной для рыббентофагов (Fagerholm, Koie, 1994 и др.). На это указывает доминирование в фауне нематод Cucullanus heterochrous и Dichelyne minutus, чьи жизненные циклы связаны с бентосной полихетой Nereis diversicolor. Активное использование в питании моллюсков родов Mya и Macoma увеличивает вероятность заражения рыб трематодами, о чем свидетельствуют высокие показатели инвазии рыб метацеркариями Cryptocotyle concava и C. lingva (табл.) .

В ходе исследования был установлен интересный факт значимого снижения c 2010 г. ЭИ рыб скребнями Pomphorhynchus laevis вплоть до их полного отсутствия в 2017 г. Причиной этого могут служить изменения в трофо–паразитарной системе Юго-Восточной Балтики, связанные с загрязнением моря, которое в свою очередь может служить причиной снижения биомассы основных промежуточных хозяев скребня (амфипод рода Gammarus) в местах активного питания рыб .

Литература

Быховская-Павловская И.Е. Паразиты рыб. Руководство по изучению / Л.: Наука, 1985 .

123 с .

Fagerholm H-P., Kie M. Parasites of flounder (Platichthys flesus) in the Baltic Sea: A Review // Diseases and Parasites of Flounder (Platichthys flesus L.) in the Baltic Sea .

BMB Publication. 1994. N. 15. P. 65–74 .

Mller H. Untersuchungen ber die Parasiten der Flunder in der Kieler Forde // Ber. Dt .

wiss. Kommn Meeresforsch. 1974. N. 23. P. 136–149 .

–  –  –

Материал и методы. В основу работы положены материалы, полученные авторами во время экспедиций и стационарных наблюдений с 2000 по 2016 гг. в Уссурийском Михайловском, Октябрьском, Спасском, Пограничном, Надеждинском, Черниговском, Чугуевском, Красноармейском, Ковалеровском, Ханкайском районах края .

При сборе материала отработано в городских объектах и других населённых пунктах более 5 тыс. ловушко–суток и отловлено 765 грызунов 3 видов, с которых собрано 5138 блох 5 видов. Изучено строение и разобран субстрат 92 гнезд, из них выбрано 205 блох, 34 гнезд использовано для наблюдения за видовым и фазовым составом популяций блох .

Результаты исследований. Нами проведен анализ жизненных циклов наиболее хорошо изученных видов блох синантропных грызунов Приморья .

Блохи синантропных грызунов являются типичными представителями с круглогодичным размножением. Это виды блох Nosopsyllus fasciatus Bosc, 1801, Monopsyllus anisus Rothschild,1907, Leptopsylla segnis Schocher, 1811 и даже не очень типичный вид блохи синантропных грызунов Приморья Xenopsylla cheopis Rothschild, 1903 .

Nosopsyllus fasciatus размножается круглогодично в связи с синантропным образом жизни основного прокормителя – серой крысы Rattus norvegicus (Berkenhout, 1769). Самки с готовыми к откладке яйцами встречаются во все сезоны. В целом, гоноактивность N. fasciatus имеет вид двухвершинной прямой с минимумом в январе и максимумом в июле-августе (рис. 1) .

Годовой ход численности этого паразита регулируется главным образом условиями развития преимагинальных фаз. При благоприятных условиях цикл развития от яйца до имаго занимает 36 дней. Таким образом, за год теоретически может развиваться до 9 генераций. При температуре воздуха 20–250С и относительной влажности 70–80% самки блох N. fasciatus начинают вылупляться из коконов через 34 дня, а самцы через 36 дней. Через 15–20 минут после выплода блохи начинают питаться, при доступности прокормителя, и нападают на хозяина до 3 раз в сутки. В отсутствии прокормителя блохи могут голодать до 10 дней. На 3–4 сутки после выплода самки приступают к откладке яиц (3–3.5 яйца в сутки). Размер первой кладки яиц обычно меньше последующих (Жовтый, 1985). Генеративный цикл длится 25–30 дней. За период жизни самка в среднем откладывает 100–150 яиц .

Рис .

1. Интенсивность размножения блохи N. fasciatus (среднемноголетняя 2000–2016 гг.) Рис. 2. Сезонная интенсивность размножения блохи M. anisus в населенных пунктах (среднемноголетние 2000–2016 гг.) Monopsillus anisus. Анализ интенсивности размножения показывает, что блоха размножается круглый год (рис.2) при паразитировании в условиях Приморского края на серой крысе. Однако с наступлением весны интенсивность размножения усиливается. Количество самок созрелыми яйцами начинает увеличиваться в марте, достигает максимума в мае-июне, а затем плавно снижается и с небольшими колебаниями регистрируется до начала весеннего подъема следующего года. Пик интенсивности размножения блох совпадает по срокам с началом активного размножения прокормителя. При оптимальных условиях может развиваться до 9–10 поколений в год .

Leptopsylla segnis. Паразитирует на домовой мыши Mus musculus Linnaeus,1758. Размножение блох регистрируется круглый год. Изменение количества яйцекладущих самок носит волнообразный характер (рис. 3). Спады и подъемы численности самок со зрелыми яйцами повторяются с интервалом в один месяц. Среднегодовой процент размножающихся самок очень высок (61.4%), в отдельные месяцы (апрель, октябрь, декабрь) он приближается к 80% .

Xenopsylla cheopis Размножение блохи с разной интенсивностью наблюдается круглый год (рис. 4), но максимальная активность приходится на летние месяцы (июнь-август) и в год развивается два–три поколения блох .

За время жизни самка способна отложить до 350 яиц. По-видимому, именно высокая плодовитость позволяет блохе выжить в условиях юга Приморья .

Рис. 3. Динамика размножения L. Segnis на домовой мыши (среднемноголетние 2000–2016 гг.)

Рис.к 4. Сезонная динамика размножения блохи X. cheopis (среднемноголетние 2000–2016 гг.)

Заключение. Приведенными сведениями, по всей вероятности, не исчерпывается все разнообразие сезонных экологических ритмов у синантропных блох Приморья. Следует продолжить детальные исследования их сезонной жизни с круглогодичными наблюдениями .

Специальных исследований диапаузы у блох практически не проводилось .

Фактическая сторона этого аспекта ограничивается данными по фенологии существования и размножения имаго .

O РАСПРОСТРАНЕНИИ КИНЕТОПЛАСТИД У РЫБ В

НЕКОТОРЫХ ВОДОТОКАХ И ВОДОЕМАХ

МОНГОЛЬСКОЙ ЧАСТИ БАССЕЙНА Р. СЕЛЕНГИ

Мазур О.Е., Бурдуковская Т.Г., Батуева М.Д .

ФГБУН Институт общей и экспериментальной биологии СО РАН, 670047 Улан-Удэ, ул. Сахьяновой, 6, Россия; olmaz33@yandex.ru Кровепаразиты сем. Trypanosomatidae (класс Kinetoplastea Honigberg, 1963) ? большая группа эукариотических жгутиконосцев, часть жизненного цикла которых проходит в кровеносной системе хозяина. Широко распространенными для рыб являются гемофлагеллята родов Trypanosoma (Gruby, 1843) и Trypanoplasma (Laveran et Mesnil, 1901). Исследователи уделяют особое внимание этим группам жгутиконосцев в связи с их патогенностью для рыб (Bunnajirakull et al., 2000; Losev et al., 2015) .

Несмотря на масштабно проводимые паразитологические исследования гидробионтов р. Селенги сведения по зараженности рыб кровепаразитами единичны (Заика, 1965; Пугачев, 2001), а анализ доступной литературы показал отсутствие данных об инвазии ими рыб на территории монгольской части бассейна реки .

В данной работе впервые представлены данные по фауне кровепаразитов различных таксономических групп рыб бассейна р. Селенги (Монголия) .

Материал и методы. Материалы получены в июне–июле 2011 и 2013 гг .

в составе Совместной Российско–Монгольской комплексной биологической экспедиции РАН и АНМ. Отбор проб проводили на реках Селенги и Орхон, озерах Угий– Нур и Хубсугул (табл.) .

Всего исследовано 273 экз. рыб разных размерно–возрастных групп. Жгутиконосцев выявляли микроскопией (объектив 20), путем подсчета в 300 полях зрения микроскопа на сухих окрашенных препаратах крови. Первичную видовую идентификацию гемофлагеллят осуществляли морфометрически .

При анализе данных использовали общепринятые паразитологические индексы: экстенсивность инвазии (ЭИ,%), интенсивность инвазии (ИИ, экз.), индекс обилия (ИО, экз.) .

Таблица. Характеристика районов исследования Стан- Координаты Река, озеро Пояснения ция, с.ш. в.д .

№ выше впадения р. Эгий-Гол 49°22836841 103°36829843 р. Селенга 1 (устье р. Хужирын-Гол и 49°22028 103°36041 протока Мухорын-Нуга) русло р. Орхон, напротив г .

р. Орхон 2 50°13738 106°11911 Сухэ-Батор оз. Угий– Нур 3 47°46505 102°43302 вблизи устья протоки Хугшин оз. Хубсугул 4 51°2961 100°3970 Ханхинский залив Результаты и обсуждение. В ходе работы из 13 исследованных видов рыб монгольской части бассейна р. Селенги впервые кровепаразиты были обнаружены у 4: ленка (ст. № 1, n=5 экз.), косогольского хариуса (ст. № 4, n=17 экз.), окуня (ст. № 3, n=15 экз.), язя (ст. № 2, n=1 экз.). Свободными от паразитов родов Trypanosoma и Trypanoplasma оказались: ленок (ст. 4, n=15 экз.), окунь (ст. 2, n=5 экз. 3 и 4), обыкновенная щука (ст. № 2 и 3), елец (ст. № 1 и 2), язь (ст. № 3), плотва (ст. № 3 и 4), серебряный карась (ст. № 1), амурский сазан (ст. № 3), обыкновенный гольян (ст. № 1), сибирская щиповка (ст. № 1), амурский сом (ст. № 2 и 3), налим (ст. № 1 и 4) .

В составе фауны кровепаразитов рыб исследуемых водоемов предварительно (на основе морфометрических и морфологических данных) выявлены Trypanosoma percae у окуня и неопределенные до вида жгутиконосцы Trypanosoma sp. у язя и Trypanoplasma sp. у косогольского хариуса, ленка и язя. Экстенсивность заражения трипаносомами (T. percae) у окуня составила 73.3%, при ИИ 0–38 экз. (средняя интенсивность инвазии – 14.81 экз.) и ИО

10.86 экз. Жгутиконосцы рода Trypanosoma sp. были также обнаружены у одного язя в единичном экземпляре из р. Орхон. Трипаноплазмой (Trypanoplasma sp.) заражены ленок (ЭИ 20%, ИИ 0–3 экз. и ИО 0.6 экз.) из р. Селенга и язь, выловленный в р. Орхон в единственном экземпляре, с ИИ в 7 экз. Анализ исследования показал зараженность косогольского хариуса только Trypanoplasma sp., которая составила 5.9%, при ИИ 0–8 экз., ИО 0.47 экз .



Таким образом, впервые в бассейне р. Селенги на территории Монголии гемофлагеллята зарегистрированы в целом у 30.8% исследуемых рыб. Наиболее высокие показатели паразитарной инвазии кровепаразитами отмечены у окуня, отловленного в оз. Угий–Нур, тогда как у окуня из других станций исследования эта группа паразитов не обнаружена. Для фауны гемофлагеллят других видов рыб (ленок, косогольский хариус и язь) отмечена единичная встречаемость этими паразитами .

Циркуляция Trypanosoma sp. в крови рыб обусловлена экологическими особенностями этой паразитарной системы: присутствием кровососущих пиявок – хозяев кинетопластид, в которых проходит часть жизненного цикла паразитов. Поэтому зараженность трипаносомами у исследуемых рыб различна и, вероятно, определяется трофическими и топическими связями с пиявками и связана с гостальной специфичностью паразитов .

Следует отметить, что в последние годы исследователями начата ревизия фауны кровепаразитов пресноводных рыб с помощью определения их генетической видовой разнородности на основе молекулярных методов (Gu et al., 2007;

Losev et al., 2015 и др.). В результате была обнаружена значительная гетерогенность гемофлагеллят у особей одного вида. Поэтому имеются веские основания в использование молекулярно-генетического анализа для уточнения и определения видового состава кровепаразитов рыб Байкальского региона. При этом по нашему мнению, применение морфологической идентификации паразитов создаст базу для дальнейших более точных исследований .

Выражаем благодарность Д. Тумурсух (Институт геоэкологии АНМ, Монголия) за неоценимую помощь в полевых работах .

Работа выполнена по проекту № АААА-А17-117011810039-4 .

Литература Заика В.Е. Паразитофауна рыб озера Байкал. М.: Наука, 1965. 106 с .

Пугачёв О.Н. Каталог паразитов пресноводных рыб Северной Азии. Простейшие // Тр. Зоол. ин-та РАН. СПб.: ЗИН РАН, 2001. 242 с .

Bunnajirakull S., Steinhagenl D., Hetzel U., Korting W., Drornrner W. A study of sequential histopathology of Trypanoplasma borreli (Protozoa: Kinetoplastida) in susceptible common carp Cyprinus carpio // Dis. Aquat. Org. 2000. V. 39. P. 221–229 .

Gu Z., Wang J., Li M., Zhang J., Ke X., Gong X. Morphological and genetic differences of Trypanosoma in some Chinese freshwater fishes: difficulties of species identification // Parasitol. Res. 2007. № 101. P. 723–730 .

Losev A., Grybchuk-Ieremenko A., Kostygov A.Y., Lukeљ J., Yurchenko V. Host specificity, pathogenicity, and mixed infections of trypanoplasms from freshwater fishes // Parasitol .

Res. 2015. № 114. P. 1071–1078 .

КЛЕТОЧНЫЙ СОСТАВ СЕЛЕЗЕНКИ СЕРЕБРЯНОГО

КАРАСЯ, ЗАРАЖЕННОГО LIGULA (DIGRAMMA)

INTERRUPTA (CESTODA: PSEUDOPHYLLIDEA)

Мазур О.Е., Кутырев И.А., Дугаров Ж.Н .

ФГБУН Институт общей и экспериментальной биологии СО РАН, 670047 Улан-Удэ, ул. Сахьяновой, 6, Россия; olmaz33@yandex.ru Ligula interrupta рода Ligula (Digramma) (Сestoda: Pseudophyllidea) – ремнец пресноводных карповых рыб, плероцеркоиды которого локализуется в полости тела. Карась серебряный Сarassius auratus gibelio Linnaeus, 1758 – доминантный дополнительный хозяин L. interrupta. Паразит, являясь чрезвычайно патогенным для своего хозяина, оказывает массивное механическое, гормональное, антигенное воздействие на организм, инициируя атрофию и нарушения функциональной деятельности внутренних органов, в т.ч. редукцию гонад (Дубинина, 1966; Кошева, 1975) .

Селезенка рыб – полифункциональный орган, участвующий в кроветворении и в иммунных реакциях организма (Zapata et al., 1996). Ее основная функция это распознавание чужеродных для организма антигенов и синтез антител. Характер паразито-хозяинных отношений во многом определяется ее способностью специфично модулировать защитные реакции в ответ на заражение. Тем не менее, в литературе отсутствует описание цитоморфологической характеристики селезенки рыб при заражении L. interrupta .

В данной работе приведены результаты исследования лейкоцитарного состава селезенки серебряного карася, зараженного L. interrupta в условиях нативного ареала .

Материал и методы. Биологический материал получен от особей серебряного карася из озер Шилэн Еравнинского района Республики Бурятия. Морфо–биологические и паразитологические исследования были проведены по общепринятым в ихтиологии методикам (Быховская-Павловская,1985). Выборка рыб состояла из неводных уловов одного размерно–возрастного состава (возраста 3+ – 5+, длина тела соответственно 145–237 и 150–180 мм, масса

– 100–184 и 120–174 г.), не зараженных и зараженных L. interrupta особей .

Для исследований были взяты отпечатки селезенки, которые окрашивали азур– эозином по Романовскому–Гимза. Подсчет клеток производили при помощи светового микроскопа MC300 (Micros, Австрия) при увеличении в 1350 раз .

Для каждой группы рыб (незараженные и зараженные) был произведен подсчет по 3000 клеток .

Результаты исследований статистически обрабатывали с помощью пакета программ Statistica 6.0 .

Результаты и обсуждение. Был впервые идентифицирован лейкоцитарный состав селезенки серебряного карася при заражении L. interrupta (таблица). У всех исследуемых особей карася среди лейкоцитов селезенки преобладали клетки лимфоидного ряда (до 80.9%). Гранулоциты составляли лишь 4.0–6.6%. Интенсивные процессы лейкопоэза подтверждаются большим содержанием бластов (12.5–14.7%) .

У карасей, зараженных L. interrupta, по сравнению с незараженными особями, среди гранулоцитов наблюдается значимое увеличение числа нейтрофилов, в основном за счет метамиелоцитов, палочкоядерных и сегментоядерных форм (в 2; 2,1 и 10 раза соответственно). Число остальных гранулоцитов остается неизменным. Общее число лейкоцитов лимфоидного ряда не изменяется, однако происходит значимое изменение соотношения зрелых и незрелых форм. Так, число пролимфоцитов уменьшается в 1.5 раза, а содержание зрелых лимфоцитов, наоборот возрастает в 3.8 раза. В селезенке незараженных особей карася было отмечено небольшое число эозинофильных форм лейкоцитов .

Таким образом, в селезенке зараженных рыб, являющейся основным местом стимуляции развития адаптивного иммунитета, наблюдается усиление процессов пролиферации и созревания гранулоцитов. Нейтрофилы – клетки с фагоцитирующей функцией, и увеличение их числа, вероятно, связано с активной миграцией на фоне мобилизации антибактериальной и антитоксикационной защиты в условиях высокопатогенной инвазии диграммами .

Параллельно активации неспецифического иммунного ответа, в виде органной нейтрофилии, в лимфоидном звене наблюдается иммунологический дисбаланс, свидетельствующий о не адекватной реакции компенсаторных процессов лимфоидной ткани органа. Более высокое число эффекторных лимфоцитов указывает на их активное участие в иммунном процессе при диграммозе, вероятно, в результате их рекрутирования. Вместе с тем, наблюдаемое ингибирование их пролиферативной активности, свидетельствует об Таблица. Изменение лейкоцитарного состава селезенки C. auratus при заражении L. interrupta (%) .

–  –  –

Быховская-Павловская И.Е. Паразитологическое исследование рыб: Руководство по изучению / Л.: Наука, 1985. 121 с .

Дубинина М.Н. Ремнецы (Cestoda: Ligulidae) фауны СССР / М.–Л.: Наука, 1966. 261 с .

Кутырев И.А., Пронин Н.М., Дугаров Ж.Н. Лейкоцитарный состав головного отдела почки карася серебряного Carassius auratus gibelio (Cypriniformes: Cyprinidae) и влияние на него инвазии цестоды Digramma interrupta (Cestoda: Pseudophyllidae) // Изв. РАН. Сер. биол. 2011. № 6. С. 759–763 .

Alvarez-Pellitero P. Fish immunity and parasite infections: from innate immunity to immunoprophylactic prospects // Vet. Immunol. Immunopathol. 2008. Vol. 126. P. 171– 198 .

Zapata A.G., Chiba A., Varas A. Cells and tissue of the immune system of fish // The Fish immune system, organism, pathogen and Environment. G. Iwama and T. Nakanishi (Eds), Academic press, San Diega, California, USA. 1996. P. 1–62 .

–  –  –

Наиболее полные сведенья о видовом разнообразии и географическом распространении гименолепидид грызунов России представлены в «Определителе гельминтов грызунов фауны СССР» (Рыжиков и др., 1978), который по сей день является основным пособием при определении видов этих цестод. Однако данный определитель был составлен по уже устаревшим к тому времени сводкам К.И. Скрябина и Е.М. Матевосян (1948) и А.А. Спасского (1954), следовательно, опубликованные в нем данные не отражают реально существующее видовое разнообразие гименолепидид и являются устаревшими. Кроме того, морфологические описания большинства цестод грызунов противоречивы и неполны, что затрудняет их точную видовую диагностику .

Использование этого определителя в исследованиях фауны гельминтов грызунов часто приводит к неправильному определению видовой принадлежности гименолепидид .

Согласно этой сводке у грызунов бывшего СССР зарегистрировано 14 специфичных видов гименолепидидных цестод из 4-х родов (Armadolepis Spassky, 1954; Hymenolepis Weinland, 1858; Limnolepis Spassky et Spasskaja, 1954 и Rodentolepis Spassky, 1954). Данный видовой список нуждается в основательной ревизии, т.к. к настоящему времени систематическое положение многих таксонов изменилось, а некоторые из них утратили самостоятельность .

Кроме того, за прошедшие годы для фауны России описан ряд новых видов гименолепидид грызунов. Далее будет рассмотрена фауна гименолепидид грызунов России на основе ревизии данных определителя Рыжикова и др .

(1978) и с учетом последних таксономических изменений этих цестод .

У грызунов на территории бывшего СССР ранее был зарегистрирован единственный представитель рода Armadolepis – A. myoxi (Rudolphi, 1819), являющийся специфическим паразитом соневых Европы. В России эта цестода достоверно обнаружена не была, однако, в ходе изучения фауны гельминтов сонь европейской части России и Северного Кавказа выявлено два новых вида Armadolepis (A. dryomi Makarikov, Stakheev et Tkach, 2018 и A .

longisoma Makarikov, Stakheev et Tkach, 2018) .

Из рода Hymenolepis на территории России ранее обнаруживали только широко распространенные виды: H. diminuta (Rudolphi, 1819); H. horrida (Linstow, 1901) и H. megaloon (Linstow, 1901). Еще два вида Hymenolepis (s. l.)

– H. ognewi Skrjabin, 1924 и H. skrjabiniana Achumian, 1947 отмечены у песчанок Центральной и Юго-западной Азии за пределами России. Относительно недавно от лесных мышей Сибири и Дальнего Востока описан еще один вид этого рода – H. apodemi Makarikov et Tkach, 2013 .

Цестода H. horrida переведена в род Arostrilepis Mas-Coma et Tenora, 1997 .

Кроме того, на основе морфологических и молекулярных методов показано, что данный таксон представляет собой сборную группу криптических видов распространенных в пределах Голарктики. В ходе ревизии этого комплекса описано 12 новых видов Arostrilepis, из них на территории России зарегистрировано минимум 7 видов: A. beringiensis (Kontrimavichus et Smirnova, 1991);

A. gulyaevi Makarikov, Galbreath et Hoberg, 2013; A. intermedia Makarikov et Kontrimavichus, 2011; A. janickii Makarikov et Kontrimavichus, 2011; A .

macrocirrosa Makarikov, Gulyaev et Kontrimavichus, 2011; A. microtis Gulyaev et Chechulin, 1997 и A. tenuicirrosa Makarikov, Gulyaev et Kontrimavichus, 2011 .

Род Limnolepis объединяет преимущественно паразитов куликов, от грызунов был известен единственный вид – L. transfuga Spassky et Merkusheva,

1967. Изначально эта цестода была описана от водяной полевки Белоруссии, позднее ее обнаружили у полевок юга Западной Сибири. Данный вид переведен в род Arvicolepis Makarikov, Gulyaev et Chechulin, 2005 .

Из 7 видов рода Rodentolepis, указанных в определителе, в пределах России было отмечено 5: R. asymmetrica (Janicki, 1904); R. merionis Tokobajev et Erculov, 1966; R. microstoma (Dujardin, 1845); R. sinensis (Oldham, 1929) и R .

straminea (Goeze, 1782). К данному списку необходимо добавить R. fraterna (Stiels, 1906) и R. nana (Siebold, 1852). Эти виды были сведены в синонимы с R. straminea А.А. Спасским (1954), позднее их самостоятельность была восстановлена. Недавние исследования данной группы цестод показали, что род Rodentolepis (s. l.) является сборным, немонофилетическим таксоном. В ходе его ревизии некоторые виды были переведены из Rodentolepis (s. l.) во вновь созданные роды – Pararodentolepis Makarikov et Gulyaev, 2009 и Nomadolepis Makarikov, Gulyaev et Krivopalov, 2010. На территории России зарегистрировано 2 вида Pararodentolepis: P. fraterna и P. sinistra Makarikov et Gulyaev,

2009) и 4 вида Nomadolepis: N. ellobii Makarikov, Gulyaev et Krivopalov, 2010;

N. fareasta Makarikov, Mel’nikova et Tkach, 2015; N. merionis и N. shiloi Makarikov, Mel’nikova et Tkach, 2015. Род Rodentolepis (s. l.) предположительно включает 5 видов. Тем не менее, таксономическое преобразование этого комплекса еще не завершено, т. к. систематическое положение ряда видов нуждается в уточнение, и, по всей вероятности, в данной группе цестод необходимо выделить еще несколько новых родов .

Недавно у ондатры в Восточной Сибири обнаружена североамериканская цестода Rodentolepis (s. l.) evaginata Barker et Andrews, 1915 (Кривопалов и др., 2013). Таксономическое положение данного вида необходимо уточнить .

Также новым для фауны России является монотипичный род Relictolepis Gulyaev et Makarikov, 2007 с типовым видом R. feodorovi Gulyaev et Makarikov,

2007. Данная цестода была описана от красно–серой полевки с юга Дальнего Востока .

Следует отметить, что у грызунов в различных регионах бывшего СССР неоднократно регистрировали случайное заражение гименолепидидами сухопутных птиц из рода Passerilepis Spassky et Spasskaja, 1954. Позднее было доказано, что у желтогорлой мыши Западной Европы паразитирует специфичная цестода Microsomacanthus murissylvatici (Rudolphi, 1819), которая морфологически очень близка к некоторым видам Passerilepis. Не исключено, что данный вид у грызунов на территории России ошибочно принимали за случайное паразитирование цестод воробьиных птиц. Таксономическое положение данного вида необходимо уточнить .

Такими образом, видовое богатство гименолепидид грызунов значительно выше, чем предполагалось ранее. Фауна этих цестод в России насчитывает минимум 27 валидных видов из 9 родов. Изучение географического распространения и ревизия таксономической структуры Hymenolepididae млекопитающих являются актуальными вопросами. Вероятно, исследование малоизученных хозяев и регионов может выявить новые виды гименолепидид .

Поддержано грантом РФФИ (№17-04-00227-a) и Программой фундаментальных научных исследований (ФНИ) государственных академий наук на 2013-2020 гг., проект № VI.51.1.5 (АААА-А16-116121410121-7) .

Литература

Кривопалов А.В., Фомина А.С., Мазур О.Е., Фоменко Н.В., Тикунова Н.В. Находка Rodentolepis evaginata (Barker & Andrews, 1915) Spasskii, 1954 (Cestoda, Hymenolepididae) у ондатры из дельты реки Селенга // Материалы V Съезда Паразитологического общества при РАН: Всероссийской конференцией с международным участием (23–26 сентября 2013 г.). Новосибирск: Грамонд. 2013. С. 96 .

Рыжиков К.М., Гвоздев Е.В., Токобаев М.М., Шалдыбин Л.С., Мацаберидзе Г.В., Меркушева И.В., Надточий Е.В., Хохлова И.Г., Шарпило Л.Д. (ред.) / Определитель гельминтов грызунов фауны СССР. Цестоды и трематоды. М.: Наука, 1978. 232 с .

Скрябин К.И., Матевосян Е.М. Гименолепидиды млекопитающих / Тр. ГЕЛАН СССР .

М.: Изд-во АН СССР, 1948. Т. I. С.15–92 .

Спасский А.А. Классификация гименолепидид млекопитающих / Тр. ГЕЛАН СССР .

М.: Изд-во АН СССР, 1954. Т. 7. С. 120–167 .

–  –  –

Гельминты рукокрылых Кавказа изучены недостаточно. Имеются лишь единичные публикации, посвященные изучению отдельных групп гельминтов малого Кавказа. Например, некоторые сведения по фауне трематод рукокрылых Армении содержатся в работе Мовсесяна и др. (2004). Подобных исследований на территории Северного Кавказа не проводилось .

В ходе изучения гельминтов рукокрылых республики Адыгея, собранных в летний период 2014 г., у двух видов подковоносов (Rhinolophus hipposideros Bechstein,1800 и R. ferrumequinum (Schreber,1774)), обнаружены трематоды .

Эти гельминты по комбинации таких отличительных признаков, как положение половой поры позади брюшной присоски и яичника, расположенного в заднем конце тела, были отнесены к семейству Mesotretidae Poche, 1926 .

Mesotretidae – небольшая группа плагиорхиоидных трематод, паразитирующих в кишечнике рукокрылых (в основном у представителей семейств Rhinolophidae Gray, 1825 и Miniopteridae Dobson, 1875). В состав семейства входит только один род Mesotretes Braun, 1900 и четыре вида. Типовой вид Mesotretes peregrinus Braun, 1900 преимущественно распространен в Европе (Италии, Франции, Швейцарии и на территории бывшей Чехословакии), а так же в Турции (Стамбул) и Туркменистане (Matskasi, 1967).

Еще три вида:

Mesotretes jiyuanensis Ma, Yu et Peng, 2009; M. hangzhouensis Sun, Jiang et Yan, 1988; M. orientalis Sun et Jiang, 1987 известны как паразиты рукокрылых семейства Rhinolophidae Китая .

Обнаруженные нами трематоды по морфологическим признакам были отнесены к европейскому виду Mesotretes peregrinus. Этот вид является новым для фауны гельминтов рукокрылых Северного Кавказа и России в целом .

Ввиду того, что данную трематоду неоднократно находили в различных частях Европы и Азии, этот пример может являться еще одним подтверждением того, что рукокрылые участвуют в распространении гельминтов .

Поддержано грантом РФФИ (№17-04-00227-a) и Программой фундаментальных научных исследований (ФНИ) государственных академий наук на 2013-2020 гг., проект № VI.51.1.5 (АААА-А16-116121410121-7) .

–  –  –

Фитопаразитические нематоды являются одной из главных причин потери урожая продовольственных культур во всех странах мира. По оценкам мирового сельского хозяйства ежегодный ущерб, наносимый фитопаразитами, оценивается в размере 125 миллиардов долларов США в год. Современные способы управления фитонематодными инвазиями в значительной степени включают применение высокотоксичных пестицидов (нематицидов), которые наносят вред окружающей среде и уменьшают биоразнообразие почв в результате уничтожения множества почвенных беспозвоночных организмов (British Ecological Society (BES): 2009) .

Эти проблемы положили началу поиска новых антипаразитарных веществ, молекулярно-биологические мишени для которых у растительных паразитических нематод (по аналогии с паразитическими нематодами животных и свободноживущими нематодами), могут быть локализованы в различных отделах нервно-мышечной системы .

Данное сообщение имеет отношение к проблеме выявления и выяснения функциональной роли эндогенных биологически активных пептидов, таких как FMRFамид-подобные нейропептиды, в центральной и периферической нервной системах растительных паразитических нематод .

FMRFамид-подобные пептиды относятся к самому большому и наиболее разнообразному по структуре семейству нейропептидов, обнаруженных у беспозвоночных животных, в том числе, у представителей типа Nematoda, которые способны модулировать различные поведенческие реакции животных, включая локомоции, питание, репродукцию, сенсорное восприятие (Peymen et al., 2014) .

В литературе представлены немногочисленные сведения о выявлении FMRFамид-подобных нейропептидов в различных структурах центральной и периферической нервных систем у цистообразующих и галловых растительных паразитических нематод .

Наиболее опасными патогенами на территории РФ, вызывающими большие потери урожая зерновых, овощных культур и картофеля, являются цистообразующие нематоды семейства Heteroderidae: пшеничная нематода Heterodera filipjeveri, свекловичная нематода H. schachtii, соевая нематода H .

glycines и картофельные цистообразующие нематоды Globodera rostochiensis и Globodera pallida .

FMRFамид-подобная иммуноактивность обнаружена у инвазионных личинок 2-го возраста соевой нематоды H. glycines в циркумфарингальном нервном кольце, в вентральном нервном стволе, в нейронах, иннервирующих медианный бульбус фаринкса, в двух ганглиях на каждой стороне вентрального нервного ствола и в амфидальных карманах (Atkinson et al., 1988) .

У нематод Globodera pallida и G. rostochiensis FMRFамид-подобная иммунореактивность была выявлена в дорзальном и вентральном нервных стволах, в околофарингальном (циркумфарингальном) и прианальном нервных кольцах, в дорзальных и вентральных ганглиях, в нервах, иннервирующих фарингальный бульбус, в нейронах, иннервирующих вытягивающую мышцу (протрактор) стилета (Kimber et al., 2001) .

У галловых нематод FMRFамид-подобная иммунореактивность также была выявлена в различных отделах нервной системы (Johnston et al., 2010) .

В частности, у инвазионной личинки 2-ого возраста нематоды Meloidogyne incognita положительное окрашивание выявлено в циркумфарингальном нервном кольце, латеральных ганглиях, в вентральном нервном стволе, вентральных и дорзальных фарингальных нервах, направляющихся к метакорпальному бульбусу, который имеет хорошо развитую мускулатуру и контролирует работу фарингального насоса в процессе засасывания пищи нематодами .

У цистообразующих и галловых фитонематод с помощью молекулярногенетических методов идентифицированы гены, кодирующие ряд FMRFамидподобных нейропептидов (flp-гены) (Kimber et al., 2001; Johnston et al., 2010) .

У цистообразующих фитонематод на примере нематоды G. pallidа идентифицировано пять генов (gpflp-1 – gpflp-5), кодирующих ряд FMRFамид– подобных нейропептидов, и выявлена экспрессия генов в многочисленных нейронах, контролирующих различные физиологические функции у нематоды (Kimber et al., 2001) .

У галловых нематод Meloidogyne incognita и Meloidogyne minor аналогичными методами определены гены Mi-flp-1, Mi-flp-7, Mi-flp-12, Mi-flp-14 и Mmflp-12, кодирующие ряд FMRFамид-подобных нейропептидов, часть из которых необходима нематодам в течение эндопаразитической стадии жизненного цикла, а другие обладают различными эффектами при воздействии на соматическую мускулатуру и мускулатуру внутренних органов физиологической модели – нематоды Ascaris suum (Johnston et al., 2010) .

Таким образом, сведения о наличии FMRFамид-подобных нейропептидов у растительных паразитических нематод и flp-генов, кодирующих эти биологически активные пептиды, экспрессии flp-генов в нервных структурах, иннервирующих соматическую мускулатуру и мускулатуру внутренних органов фитонематод, а также тот факт, что структурные гомологи этих эндогенных биологически активных пептидов могут значительно модулировать мышечную активность стенки тела, фаринкса и репродуктивных органов у паразитических нематод животных и свободноживущих нематод, служат в поддержку точки зрения о том, что выявленные нейропептиды играют важную роль в контролировании естественных поведенческих реакций – локомоций, питания, репродукции у фитонематод .

Различные формы воздействия на эти поведенческие реакции фитогельминтов, реализуемые при участии FMRFамид-подобных нейропептидов, могут представлять собой эффективные способы регулирования численности нематодной инвазии зерновых и овощных культур, включая картофель .

Литература Atkinson H.J., Isaac R.E., Harris P.D., Sharpe C.M. FMRFamide-like immunoreactivity within the nervous system of the nematodes Panagrellus redivius, Caenorhabditis elegans and Heterodera glycines // J. Zool., Lond. 1988. Vol. 216. P. 663–671 .

British Ecological Society (BES): 2009. Biological Control of Plant Parasitic Nematodes (British Ecological Society (BES): 2009. Biological Control of Plant Parasitic Nematodes http: // british ecological society. Org/blog/ blog/2009/01/2009/biological-control-ofplantparasitic-nematodes/ .

Johnston M.J.G., Veigh P.M., Masler S., Fleming C.C, Maule A.G. FMRFamide-like peptides in root–knot nematodes and their potential role in nematode physiology // J. of Helminthology. 2010. Vol. 84. P. 253–265 .

Kimber M.J., Fleming C.C., Bjourson A.J., Halton D.W., Maule A.G. FMRFavmide-related peptides in potato cyst nematodes // Molecular and Biochemical Parasitology. 2001.Vol .

116. Is. 2. P.199–208 .

Peymen K., Watteyne J., Frooninckx L., Schoofs L., Beets I. The FMRFamide-like peptide family in nematodes // Frontiers in endocrinology. 2014. Vol. 5. Art. 90. P. 1–21 .

ОСНОВНЫЕ ПРИНЦИПЫ СЕРОДИАГНОСТИКИ

ГЕЛЬМИНТОЗОВ ЧЕЛОВЕКА

Маммадли1 Г.М., Джанахмедова2 Ш.Н., Садыхова2 Н.Р .

–  –  –

Национальный НИИ медицинской профилактики им. В. Ахундова, 1065, г. Баку, ул. И. Абилов, 67, кв. 8, Азербайджан, janahmedova@mail.ru Кишечные паразитозы являются наиболее распространенными паразитарными заболеваниями среди населения. Эти заболевания вызываются как гельминтами, так и простейшими. В Азербайджане выявлено около 15 видов гельминтов и 15 видов простейших, имеющих медицинское значение. Для диагностики этих паразитов используются паразитологические методы исследования (Chobanov и др., 2007) .

В настоящее время серологические методы исследования, основанные на специфическом взаимодействии антигенов и антител, широко используются в лабораторной диагностике и исследованиях паразитарных заболеваний (Токмалаев, Кожевникова, 2010) .

С другой стороны, серологические методы диагностики могут применяться в том случае, когда методы паразитологического анализа, в силу тех или иных причин, оказываются невозможными. Это может отмечаться при паразитировании в органах и тканях человека гельминта в личиночной стадии развития (эхинококкоз, альвеококкоз, трихинеллез, цистицеркоз), в фазе миграции личинок в организме хозяина (мигроаскаридоз, токсокароз, шистосомоз, начальные стадии стронгилоидоза и др.), при паразитировании только мужских особей гельминта, при неинтенсивной инвазии, а также при угасшей или еще не начавшейся репродуктивной функции паразита (Ибальдин, Кузмин, 2012;

Кишкун, 2009; Успенский и др., 2014) .

Среди серологических методов диагностики эхинококкоза широко используется следующие: иммуноферментный анализ (ИФА) (диагностический титр 1:400), реакция непрямой гемагглютинации (РНГА) (1:320), реакция латекс– агглютинации (РЛА) (1:8). Из вышеупомянутых методов ИФА является наиболее чувствительным – около 97% .

Чувствительность и специфичность серологических методов исследований не сто процентные и зависят от различных факторов. Например, при эхинококкозе, в зависимости от размера кисты эхинококка и от состояния организма, показатели РНГА и ИФА меняются (таб.1) .

Как видно из таблицы, при расположении кист в печени, оба метода имеют более высокие показатели, чем при локализации кист в легких .

При локализации кист в нескольких органах, результаты серологических методов (РНГА и ИФА) стопроцентные. С другой стороны, при печеночной локализации кист показатели результатов ИФА относительно РНГА более чувствительны, в то время как при легочной локализации показатели результатов РНГА превосходят по чувствительности результаты ИФА .

Таблица 1. Чувствительность РНГА и ИФА в зависимости от локализации паразита

–  –  –

Одновременное использование вышеупомянутых методов исследования позволяет добиться более высоких результатов .

Специфичность этих методов также не является стопроцентной и зависит, в свою очередь, от различных факторов и от сопутствующих заболеваний .

Таблица 2. Специфичность РНГА и ИФА у здоровых людей, у людей с различными заболеваниями, а также больных с эхинококкозом

–  –  –

Ибальдин А.С., Кузмин Д.Ю. Алгоритм диагностики и лечения осложненного эхинококкоза печени // Вестник хирургии Казахстана, 2012. №1. С. 32–33 .

Кишкун А.А. Иммунологические исследование и методы диагностики инфекционных заболеваний в клинической практике / М.: МИА, 2009. 712 с .

Токмалаев А.К., Кожевникова Г.М. Клиническая паразитология: протозоозы и гельминтозы / М.: МИА, 2010. 432 с .

Успенский А.В., Малахова Е.И., Уршова Т.А. Современная ситуация по паразитозам и меры борьбы с ними в России и странах СНГ (по материалам Координационных отчетов) // Росс. Паразитолог. Журнал. 2014. № 2. С. 43–50 .

Chobanov R.E., GuseinzadeSh.N., Mammadli G.M. The influence of mass outcome of the population from occupied lands to epidemiology tensity of safe territories (an axample of echinococcosis) // Natural cataclysms and qlobal problems of the modern civilization .

Baku-Эnnsbruck, 2007. P. 465–469 .

–  –  –

Государственное бюджетное учреждение Республики Крым «Керченская межрайонная ветеринарная лаборатория», 298318, г. Керчь, ул. Фурманова, 65, Россия; astrophytum-kerch@ukr.net Несмотря на давнее изучение гельминтов птиц на территории бывшего СССР, гельминтофауна Крыма далека от полной изученности. Все более-менее систематические гельминтологические исследования птиц на территории полуострова проводились при изучении гельминтов орнитофауны Украины или Азово-Черноморского региона. Что же касается конкретно Крымского полуострова, то исследования гельминтофауны птиц касались лишь отдельных видов .

Из всей орнитофауны Крыма, насчитывающей 336 видов (Бескаравайный, 2012), наиболее хорошо изучена гельминтофауна водоплавающих птиц, как имеющих хозяйственное значение (Смогоржевская, 1976). Гельминтофауна сухопутных видов изучена мало (Искова и др., 1995) .

Материал и методы. Материалом для настоящей работы послужили гельминты, найденные у большого баклана (3 экз, Азовское море, бухта Рифов, июнь 2012 г.) и ворона (1 экз., Керченский пролив, Героевка, март 2014 г.) .

Птицы были исследованы неполным паразитологическим вскрытием. Паразиты, оказавшиеся новыми для гельминтофауны птиц Крыма, были обнаружены нами в трахее большого баклана (ЭИ – 100%, ИИ – 1–2 экз.) и жёлчном пузыре обыкновенного ворона (ИИ – 29 экз.) Результаты. Новым видом для гельминтофауны большого баклана оказались нематоды, первоначально определённые нами до семейства – Syngamidae .

Более подробное изучение позволило определить их до вида – Syngamus trachea (Montagu, 1811). Это довольно распространённый вид, уже отмечавшийся у большого баклана в Палеарктическом регионе (Helminths of…, 1978), но на Крымском полуострове он отмечен впервые. Следует отметить, что гельминтофауна крымских популяций большого баклана изучена довольно подробно (Корнюшин, 2008) и обнаружение нового вида представляет определённый интерес .

Новым видом для гельминтофауны обыкновенного ворона оказались трематоды, определённые нами первоначально до рода – Brachylecithum (сем .

Dicrocoeliidae). Трематоды данного рода весьма распространены среди врановых птиц. Дальнейшее изучение позволило определить их до вида – Brachylecithum donicum (Issaitschikoff, 1919). При этом следует отметить, что гельминтофауна обыкновенного ворона является неизученной вообще как в Крыму, так и в Украине (Искова и др., 1995) .

Заключение. Проведённые нами исследования позволили внести вклад в изучение гельминтофауны птиц Крымского полуострова, в т.ч. были получены первые сведения о паразитофауне ранее совершенно неизученного в гельминтологическом плане вида – обыкновенного ворона .

Литература

Бескаравайный М.М. Птицы Крымского полуострова / Симферополь: Бизнес–Информ, 2012. 336 с .

Быховская-Павловская И.Е. Трематоды птиц фауны СССР / М.–Л.: Изд-во АН СССР, 1962. 407 с .

Искова Н.И. и др. Каталог гельминтов позвоночных Украины: Трематоды наземных позвоночных / К.:, 1995. 92 с .

Корнюшин В.В. Большой баклан (Phalacrocorax carbo L.) как потенциальный источник распространения гельминтозов рыб // Бранта: сборник трудов Азово–Чёрноморской орнитологической станции. Вып. 11. Труды научно-практической конференции. 2008. С. 200–203 .

Смогоржевская Л.А. Гельминты водоплавающих и болотных птиц фауны Украины / К.: Наукова думка, 1976. 416 с .

Helminths of Fish-Eating Birds of the Palaearctic Region I: Nematoda // Springer Science+Business Media Dordrecht. 1978. 318 p .

–  –  –

Подробные исследования фауны наземных моллюсков Беларуси, активно проводившиеся в нашей стране в последние годы (Земоглядчук, 2016; Коцур, 2013, 2014), становление специалистов по данной группе беспозвоночных, подготовило благоприятную почву для начала их изучения в качестве промежуточных хозяев гельминтов, прежде всего трематод, которые являются возбудителями опасных заболеваний разных систематических групп млекопитающих (хищных, копытных и т.д.), птиц и человека, оказывают деструктивное влияние на их популяции .

Наземные моллюски в отличие от водных (Дороженкова, 2011; Акимова, 2016), в качестве объекта паразитологических исследований на территории нашей страны ранее не рассматривались. Вследствие этого очевидна актуальность исследований в данном направлении, их необходимость, во-первых, для восполнения пробелов в структуре фауны гельминтов Республики Беларусь и пополнения данных мировой гельминтофауны, для всестороннего изучения циклов их развития на территории страны, изучения паразито–хозяинных отношений и т.д. Это в свою очередь будет способствовать разработке комплексного подхода и повышению эффективности мероприятий по борьбе с паразитарными заболеваниями домашних и диких позвоночных .

Целью работы явился анализ и обобщение информации в отношении наземных моллюсков – промежуточных хозяев гельминтов позвоночных животных как основы для исследований в данном направлении на территории Республики Беларусь .

Подробный анализ литературных материалов свидетельствует о достаточной проработанности данного вопроса в мире и на сопредельных территориях в частности. На территории Украины в указанном направлении известны работы В.И. Здун (1961; 1963; 1966), В.В. Корнюшина (1992), Н.И. Исковой (1995), В.В. Ткач (1997), Э.Н. Король (1990; 2002; 2012) и др. По литературным данным в Украине у позвоночных паразитирует 61 вид гельминтов (43 вида трематод, 2 – цестод и 16 – нематод), в жизненных циклах которых участвуют наземные моллюски (Искова, 1995), для которых здесь зарегистрировано 32 вида гельминтов (24 вида трематод, 3 – цестод, 5 – нематод) (Король, 2012). Предварительные результаты изучения Воробьевой О.В. с соавторами фауны нематод моллюсков Крыма (Воробьева и др., 2008) показывают, что уровень их зараженности (21%) значительно выше обычно наблюдаемого в Центральной Европе (менее 5%) .

На территории Польши этой тематике посвящены исследования T .

Pojmanska (1959), A. Soltys (1964), E. Urban (1972), в Болгарии – М. Панайотовой-Пенчевой, Е.С. Ивановой (2006, 2013); в условиях Казахстана –Е.В. Гвоздева, Т.Н. Соболевой (1978), В.Я. Панина (1966, 1971, 1984); на территории Узбекистана – Д.А. Азимова, А.Э. Кучбоева (2003, 2012, 2017); в Армении – С.О. Мовсесяна (2009, 2010), Д.М. Давудова (2008), Г.А. Бояхчяна (2009) .

На территории России данное направление нашло свое отражение в работах Э.А. Давтяна (1937, 1949, 1950), Т.А. Гинецинской (1959, 1968), В.Н. Озерской (1953), Н.А. Самойловской (2013), И.Н. Трушина (1973, 1975), А.А. Кириллова (2013), Т.Г. Шиховой (2007), А.А. Добровольского (2000), Ю.Ф. Петрова с соавторами (2011) и др. Причем, основное внимание было уделено изучению представителей родов Protostrongylus и Mullerius, а так же виду D .

lanceatum. К настоящему времени актуальность приобрели молекулярно–генетические исследования трематод (Атаев, 2013, 2014, 2015; Жукова, 2012, 2014 и др.) .

На территории Республики Беларусь данный вопрос затрагивается в отдельных публикациях А.Ф. Бобковой (1964), С.С. Липницкого (1999), В.Ф .

Литвинова и др. (2009. 2016). К настоящему времени на территории страны выявлено 78 видов наземных моллюсков, принадлежащих к 2 подклассам, 18 семействам и 41 роду (Земоглядчук, 2016). Литературный анализ гельминтологической зараженности данной экологической группы безпозвоночных разных регионов России, Польши, Украины, Узбекистана, Казахстана и др. определяет необходимость исследования на территории Республики Беларусь прежде всего моллюсков 26 видов: Cepaea hortensis (O.F. Muller, 1774), C .

nemoralis (L.), Trichia hispida (L.), Euomphalia strigella (Draparnaud, 1801), Helicella candicans (Pfeiffer, 1841), Monacha cartusiana (O.F. Muller, 1774), Monachoides incarnata (O.F. Muller, 1774), Perforatella bidens (Chemnitz, 1786), Bradybaena fruticum (O.F. Muller, 1774), Vitrina pellucida (O.F. Muller, 1774), Vallonia costata (O.F. Muller, 1774), Succinea putris (L.), Cochlicopa lubrica (O.F .

Muller, 1774), Brephulopsis cylindrica (Menke, 1828), Vertigo pusilla (O.F. Muller, 1774), Pupilla muscorum (L.), Clausilia cruciata (Studer, 1820), Clausilia dubia (Draparnaud, 1805). Cochlodina laminata (Montagu, 1803), Cochlodina orthostoma (Menke, 1830), Nesovitrea hammonis (Riedel, 1957), Zonitoides nitidus (O.F. Muller, 1774), Deroceras laevis (O.F. Muller, 1774), Deroceras reticulatus (O.F. Muller, 1774), Deroceras agreste (L.), Krynickillus melanocephalus (Kaleniczenko, 1851) .

Возможно обнаружение в них следующих видов трематод и цестод:

Brachylaima fuscatum (Rud., 1819), B. fulvum (Dujardin, 1843), B. recurvum (Dujardin, 1845), B. mesostoma (Rud., 1803), Leucochloridium paradoxum (Carus, 1835), L. perturbatum (Pojmanska, 1969), Urogonimus macrostomus (Rud., 1803), U. cardis (Yamaguti, 1939), Urotocus sp., Pseudoleucochloridium soricis (Soіtys,1952), Dicrocoelium dendriticum (Rud., 1819), Conspicuum popovi (Kassimov, 1952), Opisthioglyphe ranae (Frцlich, 1781), Corrigia vitta (Dujardin, 1845), Hasstilesia ovis (Orloff, Erschof et Badanin, 1937), Tamerlania zarydnyi (Skrjabin, 1924), Davainea proglottina (Davaine, 1860), Markewitchella bonini (Megnin, 1899), Monocercus arionis (Siebold, 1850). Необходимо учесть, что ряд видов (B. fulvum, B. mesostoma, U. macrostomus, D. dendriticum, D .

proglottina, P. soricis, O. ranae и др.) из года в год обнаруживаются исследователями в организме позвоночных животных нашей страны (Бычкова с соавт., 2017) .

Проанализированные материалы по распространению протостронгиллид на сопредельных территориях дают основания предполагать возможность их обнаружения в следующих видах наземных моллюсков нашей страны (35 видов): Helix pomatia (L.), Helix albescens (Rossmassler, 1835), Helix lutescens (Rossmassler, 1837), H. candicans, C. nemoralis, Cepaea vindobonensis (Pfeiffer, 1828), T. hispida, E. strigella, M. cartusiana, P. bidens, B. fruticum, V. pellucida, Discus ruderatus (Ferussac, 1821), Discus rotundatus (O.F. Muler, 1774), Vallonia pulchella (O.F. Muller, 1774), V. costata, S. putris, Succinea oblonga (Draparnaud, 1801), Oxyloma elegans (Risso,1826), C. lubrica, Ena obscura (O.F. Muller, 1774), Chondrula tridens (O.F. Muller, 1774), Vertigo antivertigo (Draparnaud, 1801), V .

pygmaea (Draparnaud, 1801), Truncatellina cylindrical (Ferussac, 1807), P .

muscorum, Clausilia pumila (Pfeiffer, 1841), Retinella petronella (Pfeiffer, 1853), Euconulus fulvus (O.F. Muller, 1774), Z. nitidus, D. agreste, D. reticulatus, Arion subfuscus (Draparnaud, 1801), Arion circumscriptus (John, 1828), B. cylindrica .

Согласно литературным данным возможно обнаружение у наземных моллюсков Республики Беларусь нематод Muellerius сapillaries (Muller, 1889), Cystocaulus nigrescens (Jerke, 1911), C. ocreatus (Railliet et Henry, 1908), Elaphostrongylus cervi (Сameron, 1931), Neostrongylus linearis (Marotel, 1913), Varestrongylus capreoli (Stroh et Schmid, 1938), V. sagittatus (Mueller, 1891), Protostrongylus tauricus (Schulz et Kadenazii, 1949), P. terminalis (Passerini, 1884), P. rufescens (Leuckart, 1865), Filaroides martis (Werner, 1782), Skrjabingylus nasicola (Leuckart, 1942), S. petrovi (Bajenov, 1936), Stichorchis subtriquetrus (Rudolphi, 1814), видов рода Crenosoma (Molin, 1861) и др. Ряд вышеуказанных видов уже описаны (Бычкова с соавт., 2017) в качестве паразитов позвоночных животных нашей страны: M. сapillaries, P. rufescens, P. terminalis, S .

nasicola, S. petrovi, S. subtriquetrus, F. martis, V. capreoli, E. cervi, Crenosoma spp. и др .

Таким образом, потенциальными промежуточными хозяевами гельминтов позвоночных животных на территории нашей страны могут явиться более 40 видов наземных моллюсков при возможном обнаружении у них более 30 видов гельминтов .

–  –  –

Роль птиц в распространении трансмиссивных заболеваний человека и животных и птичьего гриппа очевидна и требует тщательного изучения (Матюхин, Бойко, 2007: Матюхин, Бойко, 2008). Птицы и их эктопаразиты являются важным звеном в очаговом комплексе трансмиссивных болезней вирусной, риккетсиозной и бактериальной природы (Балашов, 1982; Беклемишев, 1951, 1954; Павловский, Токаревич, 1966, Бойко и др.,1972) .

Роль беспозвоночных в циркуляции арбовирусных инфекций изучается давно (Львов, Ильичев,1979), в настоящий момент привлекает внимание многих специалистов, тем не менее, к началу III тысячелетия изучена недостаточно (Матюхин, Бойко, 2007: Матюхин, Бойко, 2008) .

Вред мух – кровососок (Hippoboscidae) складывается из непосредственного вреда, приносимого ими хозяину, и вреда, приносимого кровососками в качестве переносчиков возбудителей болезней (Досжанов, 1980, 2003) .

Первые сведения о мухах кровососках Дальнего Востока приведены в работе Ю.Н. Назарова (1968) и в его диссертации. В 1964–1966 гг. на юге Приморья (п. Пейшула, Шкотовского р-на) и на острове Большой Пелис (залив Петра Великого) с апреля по сентябрь месяц было отловлено 2159 особей 171 вида 17 отрядов птиц. На 172 особях 36 видов птиц обнаружено 370 особей мух кровососок .

Белоусова Н.М (2012), изучая население членистоногих гнезд синантропных и гемисинантропных птиц селитебных районов Приханкайской равнины, отметила только три вида кровососок одного рода: Ornithomyia avicularia, O. chloropus, O. fringillina) .

Материал и методы. Исследования проводили в Лазовском заповеднике .

Отлов на паутинные сети проводили в июле: на р. Проселочная работало 5 сетей (за 7 дней поймано 108 птиц). В сентябре на р. Проселочная ловил в начале (7 дней) и в конце (4 дня) сентября (за 11 дней на 7 сетей поймано 272 птицы). В октябре (б. Петрова) в течение месяца отработано 14 дней, стояло 11 сетей, поймано 725 птиц. В ноябре (б. Петрова) ловил 3 дня – на 11 сетей поймана 51птица. Всего отловлено 1156 особей. Летом и в сентябре при выпутывании с каждой птицы слетали примерно 5–7 особей кровососок. В октябре мух было мало – слетали отдельные особи .

Результаты и обсуждение. Всего на 32 видах птиц и человеке поймано 249 особей мух двух подсемейств: Ornithomyinae (3 рода) и Lipopteninae (1 род). Из 104 особей представителей Lipopteninae 101 отловлены на человеке .

Из 104 особей Lipopteninae 101 муха (97.12%) отловлены на человеке: Lipoptena cervi (21 самец и 11 самок) и Lipoptena fortisetosa (29 самцов и 40 самок) .

Одна самка Lipoptena cervi отловлена на соловье-свистуне Luscinia sibilans .

Один самец Lipoptena fortisetosa на бледноногой пеночке – Phyll. tenellipes и одна самка этого же вида на желтогорлой овсянке – Cristemberiza elegans .

Встречаемость кровососок млекопитающих на птицах составила 2.88% .

За 7 дней июльских отловов на 48 особях 17 видов птиц: белоспинный дятел (2), зимородок (2), поползень (10), воронок (1), горная трясогузка (3), желтогорлая овсянка (8), таежная овсянка (5), светлоголовая пеночка (5), седоголовая овсянка (1), черноголовая гаичка (2), восточная синица (2), белоглазка (2), пищуха (1), желтоспинная мухоловка (1), синий соловей (1), ширококлювая мухоловка (1), бледноногая пеночка (1) собрано 50 особей O. stipituri, 24 – O. avicularia, O. fringillina – 1 особь и 2 особи C. hirundinis .

За 7 дней отлова в начале сентября (1–7) и 4 дня в конце месяца (26–29) с 37 особей 18 видов птиц: малый острокрылый дятел (1), зимородок (1), таежная овсянка (8), маскированная овсянка (1), белоглазка (10), восточная синица (7), сизый дрозд (1), синяя мухоловка (1), желтогорлая овсянка (7), седоголовая овсянка (2), красноухая овсянка (1), желтоспинная мухоловка (1), пищуха (1), ширококлювая мухоловка(1), длиннохвостая синица (1), таежная мухоловка (1), вьюрок (1), рыжая овсянка (1) было собрано 53 особи O. stipituri, 1 особь O. unicolor, 5 – O. avicularia, 1 особь O. fringillina. L. fortisetosa и L .

cervi на птицах не отмечены .

За октябрь месяц в разных местах (точках) отлова было собрано 5 особей O. stipituri (ошейниковая овсянка, сибирская горихвостка, соловей–свистун, длиннохвостая синица, седоголовая овсянка), 4 особи O. fringillina (седоголовая овсянка, гольцовый конек, восточная синица, бурая сутора), 1 особь O .

avicularia (сибирская завирушка). Все особи L. fortisetosa и L. cervi собраны только с человека .

Резюме. В июле-ноябре 2017 года на территории Лазовского заповедника отловлено 1156 особей. Всего на 32 видах птиц и человеке поймано 249 особей мух двух подсемейств: Ornithomyinae (3 рода) и Lipopteninae (1 род). Из 104 особей Lipopteninae 101 муха (97.12%) отловлены на человеке: Lipoptena cervi (21 самец и 11 самок) и Lipoptena fortisetosa (29 самец и 40 самок). Одна самка Lipoptena cervi отловлена на соловье-свистуне Luscinia sibilans. Один самец Lipoptena fortisetosa на бледноногой пеночке – Phyll. tenellipes и одна самка этого же вида на желтогорлой овсянке – Cristemberiza elegans. Встречаемость кровососок млекопитающих на птицах составила – 2.88% .

Из 249 кровососок отловленных в Лазовском заповедники 145 особей представители сем. Ornithomyinae. Самым массовым видом является O. stipituri .

Индекс встречаемости –75.17%, второй по численности O. avicularia – 17.93%, третий O. fringillina – 4.8%, две особи Cr. hirundinis – 1.3% и единственная особь Ornithoica unicolor – 0.6% .

Выражаем огромную благодарность Ерёмину Д.Ю. за помощь в сборе материала .

ли. Видоо соста птиц–хозяе и мх коососок

–  –  –

Белоусова Н.М. Население членистоногих гнезд синантропных и гемисинантропных птиц селитебных районов Приханкайской равнины / Автореф. дис. канд. биологич. наук. Владивосток, 2012. 22 с .

Бойко А.В., Аюпов А.С., Ивлиев В.Г. Кровососки (Diptera, Hippoboscidae) птиц в природных очагах клещевого энцефалита лесостепной зоны Среднего Поволжья // Паразитология. 1973. № 6. С. 536–540 .

Матюхин А.В., Бойко Е.А. Нидоценозы – как индикаторы эпизоотологического и эпидемиологического состояния окружающей среды (на примере мегаполиса) // Биоразнообразие и экология паразитов наземных и водных ценозов: Матер. Межд .

науч. конф., посвящ.130–летию со дня рожд. акад. К. И. Скрябина. М., 2008. С .

217–221 .

Назаров Ю.Н. О кровососках (Hippoboscidae) диких птиц Приморья // Материалы 13–й научной конференции ДВГУ, 1968. Ч. 3. С. 121–125 .

Назаров Ю.Н. Птицы юга Приморья и связь их с арбовирусами // Автореф. дисс. … канд. биол. наук. Владивосток, 1969. 23 с .

–  –  –

Национальный университет биоресурсов и природопользования Украины, ул. Героев Оборони 13, учебный корпус № 4, Голосеевский р/он. г. Киев, 03041, Украина, meluoxinagalina@ukr.net На территории Киевской области в течение 4-х лет проводилось изучение видового состава кокцинеллид. Жизненная форма жуков рассматривалась как наиболее общая стратегия живых организмов, которая реализуется посредством морфотипов. Габитус имаго кокцинеллид однообразен и весьма характерен для семейства в целом, что не дает оснований для выделения габитуальных типов. Это связано с тем, что кокцинеллиды населяют только наземные ярусы растительности; трофическое поведение связано в основном с обнаружением объектов питания (Drake, 2009) .

Основное направление адаптогенеза связано с трофической специализацией кокцинеллид, поеданием различного вида кормов, то есть отражается на строении ротовых аппаратов. Ротовой аппарат жуков ортоптероидный, строение мандибул кокцинеллид, как и других частей ротовых органов, отражает основные направления пищевой специализации. Следует учитывать, что многие виды с различными спектрами питания склонны к миксофагии. Остальные виды афидофагов, например, поедают также кокцид, яйцекладки и молодых личинок других насекомых, ранней весной питаются пыльцой и нектаром цветущих растений. Эта особенность характерна не для всех видов кокцинеллид. Поэтому для условий лесной среды имеет смысл выделять группу условных полифагов. По ярусам обитания на злаковых культурах выделяются следующие группы кокцинеллид: дендробионты (обитатели яруса пшеницы озимой), хортобионты (обитатели яруса ячменя ярового) и промежуточные группы дендро-хортобионты (постоянно перемещаются по ярусам тритикале), хорто-дендробионты (также способны к смене ярусов, но преобладает пребывание в травяном напочвенном покрове) (Koch, 2003) .

Трофические связи злаковых кокцинеллид изучены слабо, что, вероятно, связано с неоднозначностью этого вопроса в достаточно многообразной и динамичной злаковой среде. Биотопическая общность для довольно значительного количества видов возможна или при условии высокой степени трофической специализации, или, наоборот, – при явно выраженной полифагии (Roy, 2008) .

Материал. Экспериментальные исследования проводили в течение 2014– 2017 гг. на сорте Лыбидь в условиях стационарных опытов (агрокомпании Syngenta AG в с. Малая Вильшанка Белоцерковского района Киевской области) в посевах пшеницы озимой. Жизненные формы и видовой состав определяли в лаборатории кафедры энтомологии им. проф. М.П. Дядечко Национального университета биоресурсов и природопользования Украины .

Маршрутные обследования межвидовых природных популяций кокцинеллид проводили по общепринятым методикам в энтомологии методом подсчетом насекомых на площади 0.5 Х 0.5 м с помощью рамки в 10 – кратной повторности, а затем перечисляли на 1 м2 .

Результаты. Среди кокцинеллид злаков преобладают афидофаги. Вместе с полифагами, в основе питания которых лежит афидофагия, они составляют 60% всех кокцинеллид, обнаруженных на гектарах зерновых посевов Лесостепи Украины. Узко специализированные афидофаги – редкость. Как правило, кокцинеллиды уничтожают ряд видов злаковых тлей. В качестве дополнительного питания они используют мелких насекомых: листоблошек, личинок первых возрастов, яйцекладки и других. В той или иной степени им свойственна палинофагия (поедание пыльцы цветков), поедание нектара, других растительных выделений. Таким образом, многие афидофаги проявляют склонность к полифагии (условная полифагия), чем и объясняется их широкое распространение злаковых посевов и постоянное перемещение по ярусам зерновой растительности .

На втором месте по численности видов находятся кокцинеллиды-кокцидофаги (16.7%). По крайней мере, половина из них периодически поедает злаковых тлей, а в отдельных условиях могут питаться только ими (Exochomus flavipes, Exochomus quadripustulatus, Hyperaspis reppensis, Platynaspis luteorubra) .

Третье место по количеству видов принадлежит мицетофагам (10.4%). Это, как правило, трофически узко специализированные виды, которые в условиях злаков питаются мучнистой росой на зерновых посевах .

К категории условных полифагов относятся Adalia bipunctata, Calvia decimguttata, Calvia quatuordecimguttata, Coccinella septempunctata. Это самые многочисленные в злаковых экосистемах виды, заселяющие все ярусы зерновой растительности. Для них характерна сезонная смена объектов питания;

они оперативно реагируют на погодные особенности, периодически в условиях региона давая вспышки массового размножения. Динамика численности особей этих видов позволяет судить о состоянии гомеостаза злаковых экосистем, направлении сукцессионных процессов, проходящих в них .

Наибольшее количество жизненных форм кокцинеллид в условиях злаковых культур экосистем относится к классу зоофагов (10 жизненных форм);

этот класс лидирует и по видовому разнообразию – 37 видов (77.1%). Класс фитофагов включает пять жизненных форм, объединяющих 7 видов (14.6%) .

Класс полифагов состоит из двух жизненных форм, объединяющих два вида (4.3%) .

В условиях экосистем злаковых культур наиболее представлены хорто– дендробионты афидофаги – 12 видов (25%). На втором месте находятся дендро-хортобионты афидофаги – 7 видов (14.6%). Третье место по количеству видов занимают хорто–дендробионты кокцидофаги – четыре вида (8.3%) .

Остальные 14 жизненных форм включают по 1–3 вида .

Из анализа зонального спектра жизненных форм злаковых кокцинеллид Лесостепи Украины можно заключить следующее. Кокцинеллиды на посевах злаковых культур данного региона разнообразны по трофической специализации и занимают различные ярусы в биогеоценозах. Кокцинеллиды-зоофаги резко преобладают по видовому и численному обилию. Среди фитофагов доминируют мицетофаги. Филлофаги и палинофаги представлены по одному виду, но поедание пыльцы как дополнительного корма свойственно многим кокцинеллидам-зоофагам. Из зоофагов наиболее многочисленные хорто-дендро-, дендро-хорто- и дендробионы .

Литература

Drake J. A., Ed. Handbook of alien species in Europe. Invading Nature Springer Series in Invasion Ecology / Springer. Dordrecht, 2009. Vol. 3. 421p .

Koch R.L. The multicoloured Asian lady beetle, Harmonia axyridis: a review of its biology, uses in biological control and non-target impacts // J. Insect Sci. 2003. Vol. 32. P. 1–16 .

Roy H.E., Wajnberg E., Eds. From Biological Control to Invasion: the Ladybird Harmonia axyridis as a Model Species // Springer. 2008. 287 p. Previously published in // BioControl

– special issue. 2008. Vol. 53. (1). P. 1–292 .

ЗАРАЖЕННОСТЬ ЛЕЩА ABRAMIS BRAMA

ДИГЕНЕТИЧЕСКИМИ СОСАЛЬЩИКАМИ

ICHTIOCOTYLURUS COMMUNIS В ЗАВИСИМОСТИ

ОТ ПОЛИМОРФИЗМА ТКАНЕВЫХ БЕЛКОВ

Микряков1 В.Р., Прохорова2 И.М., Микряков1 Д.В .

Институт биологии внутренних вод им. И.Д. Папанина РАН, 152742, п. Борок, Некоузский район, Ярославской обл., mvr@ibiw.yaroslavl.ru, Ярославский государственный институт им. Демидова, 150003,

–  –  –

Приводятся данные исследований частоты встречаемости особей метацеркарий Ichtiocotylurus communis среди лещей Abramis brama, отличающихся полиморфизмом белковых фракций перикарда, на котором локализуются паразиты .

Материалом послужили 180 половозрелых леща Рыбинского водохранилища размером 260–480 мм. Сбор материала осуществляли в сентябре месяце путем траления с экспедиционного судна ИБВВ РАН «Академик Топчиев». Полиморфизм белков устанавливали методом электрофореза в 7% полиакриламидном геле. Разнокачественность белков устанавливали по количеству белковых фракций и их электрофоретической подвижности .

На протеинограммах выявлено 22 фенотипа, в том числе 15 в 1 зоне, двигающиеся со скоростью 0–0.29 см/мин, и 7 – в зоне 2 – со скоростью 0.29–0.58 см/мин. Наиболее четкие различия по фенотипам белковых спектров у пораженных и непораженных метацеркариями лещей выявлены на протеинограммах с электрофоретической подвижностью 0,29 – 0,58 см/мин .

На основании анализа белковых спектров зараженных и незараженных метацеркариями рыб выявлено 7 фенотипов тканевых белков: П1-4; П1, 3-4; П2-3;

П1-5; П1-3; П1-2; П1,3,5. Характерными для зараженных тетракотилезом лещей являются фенотипы П1-3; П1,3,5, П1-2 и П1-5, а для незараженных П1; 3-4, П2-3 и один фонотип П1-4 обнаружен среди пораженных и непораженных особей .

На основании полученных данных выдвинуто положение, что полиморфные белки составляют основу индивидуального иммунитета леща к Ichtiocotylurus communis .

–  –  –

Институт биологических проблем Севера ДВО РАН, 685000, г. Магадан, Портовая, 18, Россия; office@ibpn.ru, 8(4132)634542 Представления о закономерностях распространения неоэхиноринхов в мире можно назвать весьма ограниченными. Современный анализ распределения мировой фауны скребней этого рода принадлежит О. Амину (2002), который рассмотрел 88 признанных валидными видов. Мнение о том, что Северная Америка является центром видообразования неоэхиноринхид, было высказано Х. Ван Кливом в середине прошлого века, позднее В. Баллок также отметил их высокое видовое разнообразие на этом континенте, особенно в рыбах сем. Чукучановых. Подчеркнув бедность фауны в Европе, Африке и Южной Америке, О. Амин подтвердил справедливость ранее высказанного мнения, поскольку по его данным в Северной Америке найдено 36% видов, относящихся к роду. Также он выделил некоторые центры в Азии, в частности, индийский субконтинент, где встречается 19% известных видов (Amin, 2002) .

В настоящее время список состоит из 116 видов (Amin, 2013). Исключив из него некоторые виды, описания которых вызывают сомнения (Amin, 2002), оставшиеся по экологическим свойствам можно разделить на группы: пресноводных и морских видов, которые насчитывают 80 и 32 таксона соответственно. Имея в виду геологическую историю суши, целесообразно представить распределение пресноводных видов скребней по континентам. Данные о местах сбора типовых экземпляров, приведенные в первоописаниях, показывают, что в Евразии найдено 34 вида (в Европе – 1), в Северной Америке – 35, в Южной Америке – 8, в Африке – 3, а в Австралии не обнаружено ни одного пресноводного вида. Обращает внимание бедность фауны на материках, входивших в состав Гондваны, в то время как на материках Лавразии встречено 86% от общего количества этих видов. Не исключено, что такая ситуация связана с различным характером увлажнения этих суперматериков в эпохи их освоения рыбами (Микулин, 2003). Следует отметить, что в Азии дефинитивными хозяевами неоэхиноринхов являются рыбы, и только один вид описан от амфибии. В Северной Америке, кроме рыб, примерно треть скребней (10 видов) использует в качестве хозяев представителей сем. Пресноводных черепах. Для большинства североамериканских скребней, паразитирующих на рыбах, характерны некрупные размеры метасомы (до 20 мм), небольшой хоботок с равномерно расположенными крючьями, короткая шейка, длина которой не достигает длины хоботка, и в тегументе 4–6 дорсальных и 1–2 вентральных ядер. Межвидовые отличия при описании, главным образом, строятся на комбинации размеров хоботка и хоботковых крючьев в разных рядах. Рассматривая качественные морфологические признаки, которые служат для дифференциации неоэхиноринхов (Amin, 2002), надо отметить сходство по отдельным признакам в больших группах североамериканских видов. Так, лемнисками неравной длины обладает 10 видов, а увеличенными латеральными крючьями на хоботке в апикальном ряду – 12 видов. К последним относятся и все паразиты черепах. Кроме того, они имеют тело цилиндрической формы и достигают несколько больших размеров (30–32 мм). Для этой группы характерно то, что определить видовую принадлежность самцов по морфологическим признакам невозможно и диагностика основывается на форме заднего конца самок и строении зрелых яиц. В Азии большая часть скребней также не обладает морфологическими особенностями и подходит под общее описание, данное североамериканским видам. Здесь имеется только 3 вида с неравными лемнисками, а скребни с выделяющимися по величине латеральными крючьями отсутствуют. При этом существует группа скребней с нестандартным набором ядер в тегументе: у пяти видов присутствует 7–14 ядер с дорсальной стороны и 1–3 с вентральной, а один вид имеет всего два ядра, по одному с каждой стороны. Существенным признаком можно считать и форму яиц. Скребни, яйца которых имеют выпячивания внутренней оболочки к полюсам, были выделены в особый подрод – Hebesoma (Amin, 2002) .

В Северной Америке с таким признаком существует 5 видов, в Азии – 3. Только один вид отличается уникальной особенностью в строении: это N. didelfis Amin, 2001, локально обитающий на юге Северной Америки. Необычно устройство половой системы самок этого вида: их яйцевыводящий проток имеет два функционирующих маточных колокола .

По сравнению с представленной группой пресноводных видов анатомия морских намного разнообразнее. Кроме признаков, перечисленных для пресноводных видов, им свойственны некоторые другие, в том числе уникальные, особенности. Так, неравные лемниски отмечены у одного вида; увеличенные латеральные хоботковые крючья у трех; яйца с выпячиванием оболочки к полюсам также у трех, и нестандартный набор ядер в тегументе имеют 5 видов. Помимо этого, размер тела пяти видов достигает 44–78 мм; 9 видов обладают длинными апикальными крючьями, которые в 3–4 раза превышают длину крючьев в нижних рядах; 3 вида имеют шейку, которая длиннее хоботка в 2 раза; половая система самок двух видов отличается спирально закрученным влагалищем. У 10 видов обнаружены индивидуальные черты строения, не отмеченные для других. Они заключаются в присутствии особых образований внутри тела, вероятно, из мышечной ткани, увеличении количества ядер в лемнисках и цементной железе самцов и организации половых путей самок. Также интересно отметить, что среди 11 пресноводных видов, описанных от рыб Южной Америки и Африки, каждый обладает особенностями в строении, разделяющими эти виды, при этом все эти черты известны для морских скребней .

Исходя из сказанного выше, можно предположить, что морская фауна неоэхиноринхов, сохранившая морфологическое разнообразие, стоит ближе к изначальным формам скребней, населявшим тропические моря, а в пресных водах Северной Америки и Евразии происходила радиация немногих предковых форм. В Южной Америке и Африке, вероятно, имело место независимое вселение из прибрежных морских вод .

Обсуждая зональное распространение акантоцефалов, К.Р. Кеннеди (Kennedy, 2006) отметил, что в отличие от многих групп беспозвоночных видовое разнообразие скребней, в том числе и паразитов рыб, выше в умеренном поясе, а не в тропических широтах. В отношении неоэхиноринхов это утверждение справедливо и можно добавить, что и в высокие широты проникли лишь немногие: в Голарктике севернее 50° с. ш. встречается только 8 видов. Однако, по нашим данным, сведения о количестве северных представителей рода остаются неполными. Есть основание полагать, что в субарктических районах России существует новый для науки вид, близкий к N. tumidus Van Cleave et Bangham, 1949. Исследование нескольких особей скребней от обыкновенных гольянов, пойманных в бассейне р. Печоры, показало, что они не соответствуют первоначальному определению как N. rutili (Mller, 1780) и вероятнее всего относятся к неизвестному виду. Кроме того, в коллекции Гельминтологического Музея Центра Паразитологии ИПЭЭ РАН содержатся материалы из центральной Азии. Неоэхиноринхи, собранные в оз. Балхаш и в озерах Монголии, отнесенные к виду N. rutili, также отличаются заметным образом от указанного вида и требуют дальнейшего изучения .

Литература

Микулин А.Е. Зоогеография рыб / М: Издательство ВНИРО, 2003. 435 с .

Amin O.M. Revision of Neoechinorhynchus Stiles et Hassall, 1905 (Acanthocephala:

Neoechinorhynchidae) with keys to 88 species // Systematic Parasitology. 2002. V. 53 (1). P. 1–18 .

Amin O.M. Classification of the Acanthocephala // Folia Parasitologica. 2013. V. 60 (4). P .

273–305 .

Kennedy Clive R. Ecology of the Acanthocephala / Cambridge, Cambridge University Press, 2006. 249 p .

ОСНОВНЫЕ МОРФОЛОГИЧЕСКИЕ ПРИЗНАКИ

ПОДОТРЯДОВ ЦИКЛОФИЛЛИДНЫХ ЦЕСТОД

(CYCLOPHYLLIDEA VAN BENEDEN IN BRAUN, 1900) Мовсесян1, 2 С.О., Панайотова-Пенчева3 М.С., Теренина1 Н.Б., Никогосян2 М.А., Воронин1 М.В .

Центр Паразитологии ИПЭЭ РАН, Москва, Ленинский просп., 33, РФ, movsesyan@list.ru Институт зоологии НЦЗиГЭ НАН РА, 0014, Ереван, П. Севака, 7, Армения, zool@sci.am Институт экспериментальной морфологии, патологии и антропологии с музеем БАН, 1113,

–  –  –

В структуру циклофиллидных цестод (отряд Cyclophyllidea) входят более 1500 видов. При таком биологическом многообразии фауны одного отряда, их диагностирование, безусловно, осложнено. В связи с этим, К.И. Скрябин (1940) впервые разработал и предложил для указанной группы гельминтов таксон ранга подотряда и распределил всех циклофиллид между семью подотрядами. В связи с описаниями в последние годы ряда новых видов и надвидовых таксонов этой группы, мы провели работу по установлению ее современной систематической структуры .

Материалы и методы. Материалом для изучения морфологии служили циклофиллидные цестоды из различных семейств, собранные нами и подвергнутые камеральной обработке. Также анализировались литературные данные. Для проведения камеральной обработки цестод использовались классические методы, принятые в гельминтологии. При этом, кроме тотальных препаратов, были изучены также гистологические срезы .

Результаты. Выявлены наиболее характерные морфологические признаки для каждого подотряда циклофиллид, которые заключаются в следующем:

Acoleata Skrjabin, 1940 – гермафордитные или раздельнополые цестоды .

Бурса цирруса мышечная и вооружена крупными шипами. Вагина редуцирована, вагинальной поры нет. Зрелая матка в виде поперечнолопастного мешка. Паразиты птиц .

Anoplocephalata Skrjabin, 1933 – сколекс без хоботка и без вооружения .

Семенники многочисленны, за исключением рода Triplotaenia, у которой в каждом членике стробилы имеется лишь один семенник. Паразиты наземных членистоногих (Tetrapoda) .

Davaineata Skrjabin, 1940 – хоботок вооружен многочисленными молотковидными крючками. Матка распадается на яйцевые капсулы (сем. Davaineidae), мешковидная (Ophryocotylidae), с околоматочным органом (Idiogeniae). Паразиты птиц и млекопитающих .

Hymenolepidata Skrjabin, 1940 – хоботок сколекса вооружен одной короной крючков в количестве 8, чаще 10, редко больше. В редких случаях имеется двойная корона крючков. Число семенников 3, редко 1, 2 или больше. Паразиты птиц и млекопитающих .

Mesocestoidata Skrjabin, 1940 – сколекс без вооружения. Половые отверстия открываются в половую клоаку, расположенную вентрально, по средней линии тела. Вагина образует ряд петель. Яичники и желточники двойные .

Матка с парутеринным органом. У единственного вида Mesogyna hepatica матка лопастная, без парутеринного органа. Паразиты млекопитающих и птиц .

Личиночные формы – тетратиридии, – у млекопитающих, птиц, рептилий и амфибий .

Taeniata Skrjabin et Schultz, 1937 – хоботок вооружен двумя рядами тениоидных крючков, имеются также виды без вооружения хоботка. Матка в зрелых члениках в виде продольного ствола, от которого отходят боковые ветви .

У некоторых мелких цестод матка мешковидная или имеет форму шара (Alveococcus). Паразиты млекопитающих и птиц .

Tetrabothriata Skrjabin, 1940 – сколекс без вооружения, с четырьмя ботриями и апикальным органом. У некоторых видов сколекс цилиндрический или конусовидный, без ботридий, но имеет у своего основания мясистый воротничок (род Priapocehalus). Паразиты птиц, китообразных и ластоногих .

Обсуждение. Для систематической классификации многочисленных видов цестод отряда Cyclophyllidea van Beneden in Braun, 1900 (б. 1500 видов) К.И. Скрябин впервые предложил новый таксон – подотряд. На основании анализа морфологических признаков и филогенетической эволюции всех указанных видов цестод он распределил их между семью подотрядами. В дальнейшем А.А. Спасский (2017) предложил свою версию системы циклофиллид. В работах иностранных исследователей Yamaguti S. (1959), Khalil L.F., Jones A. and Bray R.A. (1994) таксон ранга подотряда для циклофиллид – отсутствует .

К настоящему времени в отношении таксономической классификации циклофиллидных цестод сформировались три позиции:

1. Предложенная К.И. Скрябиным таксономическая классификация отряда Cyclophyllidea (1940), состоящего из семи подотрядов – полностью оправдала себя и облегчила работу исследователей при определении видовой и надвидовой принадлежности этих цестод. Указанной позиции придерживаются и авторы настоящей статьи .

2. Позиция А.А. Спасского (2017). Эта классификация циклофиллид загромождена большим колическтвом новых таксонов, и система раздроблена настолько, что она далека от естественной .

3. Таксон ранга подотряда для классификации циклофиллидных цестод в иностранной гельминтологической литературе не указывается (Khalil, Jones, Bray, 1994) .

Заключение. Наиболее оптимальной и приемлемой мы считаем таксономическую классификацию циклофиллидных цестод, предложенную К.И. Скрябиным (1940). В то же время указанная классификация нуждается в переработке и дополнении в связи с описаниями новых таксонов циклофиллид, опубликованных после выхода работы К.И. Скрябина .

Работа выполнена при поддержке программы Президиума РАН № 41 “Биоразнообразие природных систем и биологические ресурсы России” .

Литература

Скрябин К.И., К перестройке систематики цестод отряда Cyclophyllidea (цепни) / Зоологический журнал. 1940. Т. 19, в. 1. С. 3–13 .

Спасский А.А. Биобиблиография / Кишинев, 2017. С. 46–80 .

Khalil L.F., Jones A., Bray R.A. Keys to the cestode parasites of vertebrates / CAB International, 1994. P. 305–665 .

Yamaguti S. System helminthum v. 2. / The Cestodes of vertebrates, 1959. PP.: 8, 159, 167 .

Мовсесян С.О. Систематика цестод отряда Cyclophyllidea van Beneden et Braun, 1900 / Actual problems of Zoology and Parasitology: Achivements and perspectives. Кишинев, 2017. С. 91–100 .

БИОРАЗНООБРАЗИЕ ФАУНЫ ПАРАЗИТОВ

ЖИВОТНЫХ В УСЛОВИЯХ АНТРОПОГЕННОЙ

ЭКОСИСТЕМЫ ПРЕДГОРНОЙ ЗОНЫ АРМЕНИИ

Мовсесян1,2 С.О., Петросян2 Р.А., Никогосян2 М.А., Арутюнова2 Л.Дж., Оганесян2 Р.Л., Варданян2 М.В., Рухкян2 М.Я., Барсегян2 Р.Э .

Центр Паразитологии Института Проблем Экологии и Эволюции им. А.Н.Северцова, 119071, Москва, Ленинский пр., 33, e-mail:movsesyan@list.ru; 2Институт Зоологии Научного Центра Зоологии и Гидроэкологии НАН Армении, 0014, Ереван, ул. П.Севака, 7 Экологические условия территорий предгорной зоны республики с продолжительным пастбищным периодом (9–10 мес.), высокой плотностью домашних животных на единицу площади пастбищ благоприятствуют росту биоразнообразия паразитов и зараженности ими животных в данном регионе. Экто- и эндопаразиты животных отличаются своим видовым разнообразием, которое обусловливается особенностями биотических и абиотических условий .

Целью наших исследований явилось изучение видового разнообразия эндои эктопаразитов мелких и крупных жвачных животных, домашней птицы, кроликов, рыб .

Материал и методы. Инвазированность животных экто- и эндопаразитами изучалась нами путем сбора гельминтологического материала в экспедиционных условиях в населенных пунктах и фермерских хозяйствах предгорной зоны Республики. Прижизненную диагностику проводили копрологическими исследованиями общеизвестными методами Фюллеборна, Вайда, а также седиментационным – метод последовательного промывания по К.И. Абуладзе (1975). Посмертная диагностика осуществлялась проведением послеубойной ветеринарно–санитарной паразитологической экспертизы животных по методу К.И. Скрябина (1928). У крупного и мелкого рогатого скота методом микроскопии мазков периферической крови изучали кровепаразитарные болезни. Инвазированность рыб изучалась по методу И.Е .

Быховской-Павловской (1985). Виды клещей определяли по Б.И. Померанцеву (1950). Определение динамики заклещеванности проводили сбором клещей на животных .

Результаты и обсуждение. На основании ежемесячных копроовоскопических и ларвоскопических исследований, а также полного гельминтологического вскрытия 20 голов овец (ягнята текущего года рождения и 2–5-летние овцы) выявлено 13 видов гельминтов: Dicrocoelium lanceatum, Fasciola hepatica, F. gigantica, Moniezia expansa, M. benedeni, Echinococcus granulosus larvae, Trichocephalus ovis (рис. 1), Cysticercus taenicollis (рис. 2), Nematodirus ovis, Oesophagostomum columbrianum, Haemonchus contortus, Dictyocaulus filaria, Protostrongylus spp., Muellerius capillaries .

Овцы были наиболее инвазированы дикроцелиями и желудочно–кишечными нематодами. Так, экстенсивность инвазии (ЭИ) животных стронгилятРис. 2. Cysticercus taenicollis на серозных поРис. 1. Trichocephalus ovis в толстом отделе .

кровах кишечника овцы .

ми пищеварительного тракта составила 72–90% с относительно низкой интенсивностью инвазии (ИИ); ЭИ дикроцелиями 60–80%. Echinococcus granulosus регистрировался у крупного рогатого скота (к.р.с.) в 31.4%, а у мелкого (м.р.с.) – в 24.6% случаев. У крупного рогатого скота (к.р.с.) и мелкого рогатого скота (м.р.с.) методом микроскопии мазков периферической крови установлена зараженность их кровепаразитами: у к.р.с. – Piroplasma bigeminum (рис. 3), у м.р.с. – Babesia ovis, P.ovis и Theileria ovis (рис. 4), причем инвазированность к.р.с. пироплазмами составляла 80%, а овец и коз – 60% и тейлериями 70% .

При исследовании кроликов в толстом отделе кишечника установлено паразитирование нематоды Passalurus ambiqus, цестоды Taenia pisiformis, трематоды F. hepatica, а у молодняка и у взрослых – простейших: Eimeria perforans, E. magna, E. media, E. irresidua, E. intricata, E. exigua и E. stidae. Куры были инвазированы нематодами Ascaridia galli (30%), Heterakis gallinarum (15%), куры и молодняк – простейшими Eimeria tenella, E. maxima, E. acervulina, а гуси – E. truncata .

Рис. 4. Theileria ovis и P. ovis в крови овец .

Рис. 3. Piroplasma bigeminum в крови к.р.с .

Были обследованы рыбы 5-ти видов: храмуля, усач, карась, быстрянка, карп. Общая инвазированность рыб гельминтами составляла 35% (32 экз.). У рыб были обнаружены моногенеи, трематоды и цестоды. Зарегистрировано 6 видов гельминтов: класс Monogenea – Dactylogyrus sp.; класс Trematoda – Diplostomum spathaceum, D. rutili, D. paraspathaceum; класс Cestoda – Ligula intestinalis, Bothriocephalus opsariichthydis. Определены экстенсивность и интенсивность инвазии рыб гельминтами .

Как известно клещи семейства Ixodidae являются переносчиками и резервентами возбудителей гемоспоридиозов. С этой точки зрения важно изучение иксодофауны и динамики заклещеванности животных. Иксодофауна клещей предгорной зоны Армении представлена следующими видами: Hyaloma anatolicum caucasicum, Rhipicephalus bursa, Rh. sangvineus, Boophilus calcaratus, Dermacentor marginatus. Как показали наши исследования, нападение клещей на к.р.с. и м.р.с. отмечалось с первых дней выхода животных на пастбище. В дальнейшем заклещеванность увеличивалась, достигая максимума в мае. В это время у животных отмечались клинические признаки пироплазмоза и тейлериоза у м.р.с. Доминирующими видами во все сезоны года были клещи видов Rhipicephalus bursa и Hyaloma anatolicum caucasicum. Исследованы пробы почвы, взятые из разных участков пастбищ предгорной зоны. Из этих проб выделены орибатидные клещи Scheloribates sp. – промежуточные хозяева цестод овец и коз из рода Moniezia. Вскрыто и просмотрено 70 экз. клещей .

У овец выявлено паразитирование насекомого Melophagus ovinus .

Изучены пути циркуляции некоторых биогельминтов в пастбищных биоценозах исследуемых территорий. Был проведен сбор пресноводных и наземных моллюсков и определен их видовой состав и естественная зараженность их личиночными формами гельминтов. Собрано 3 вида пресноводных моллюсков: Lymmnaea truncatula, L. auricularia, Planorbis planorbis. Личиночные формы фасциол (редии и церкарии) обнаружены в пресноводном моллюске L. auricularia. Наземных моллюсков собрано 3 вида: Chondrula tridens, Napaeopsis hohenackeri, Helicella derbentina – промежуточные хозяева дикроцелий и протостронгил .

Заключение. Природные и антропогенные факторы в условиях предгорной зоны Армении способствуют формированию очагов инвазий и росту биоразнообразия экто– и эндопаразитов. Биоразнообразие паразитов животных ежегодно возрастает с высокими показателями численности популяции в организме окончательных и промежуточных хозяев. В предгорной зоне Армении биоразнообразие паразитов крупного рогатого скота, овец и коз, кроликов, птиц и рыб включает 47 видов, в том числе трематод – 6, цестод – 8, нематод

– 9, моногеней – 1, простейших –16, иксодовых клещей – 5, орибатид – 1, насекомых – 1 вид .

Литература

Абуладзе К.И. Паразитология и инвазионные болезни сельскохозяйственных животных / М., «Колос», 1975. 459 с .

Быховская-Павловская И.Е. Паразитологическое исследование рыб / М.–Л., Изд–во АН СССР, 1952. 63 с .

Померанцев Б.И. Иксодовые клещи (Ixodidae). В кН.: Фауна СССР. Паукообразные, IV (2) / М.–Л., Изд–во АН СССР, 1950. Т. 3. 223 с .

Скрябин К.И. Метод полных гельминтологических вскрытий позвоночных, включая человека / М., изд. 1-го МГУ, 1928. 45 с .

–  –  –

Тихоокеанский научно-исследовательский рыбохозяйственный центр (ТИНРО-Центр), 690091, г. Владивосток, пер. Шевченко, 4, Россия. motora_dv@mail.ru В настоящее время, среди имеющихся публикаций о колючеголовых червях рыб, нет такой в которой обобщается видовой состав скребней морских рыб Японского моря. Используя собственный материал, полученный при вскрытии 2278 экз. рыб 43 видов из 9 отрядов, 13 семейств, 35 родов и литературные данные (70 источников, из них 36 иностранных авторов), был составлен предварительный список акантоцефал морских, проходных и полупроходных рыб Японского моря. Кроме того, проведено сравнение видового состава акантоцефал различных семейств рыб, рыб разных экологических групп (проходные и полупроходные, донные, придоннопелагические) .

У морских, проходных и полупроходных рыб Японского моря зарегистрировано 77 видов колючеголовых червей 25 родов, 10 семейств: (Quadrigyridae

– 1 род, Neoechinorhynchidae – 1, Arhytmacanthidae – 3, Cavisomidae – 2, Diplosentidae – 1, Echinorhynchidae – 3, Illiosentidae – 3, Pomphorhynchidae – 2, Rhadinorhynchidae – 6, Polymorphidae – 3), 4 отрядов и 2 классов. В северо– западной части моря (побережье Приморского края) отмечено 36 видов, 4 отрядов, 7 семейств, 13 родов. Разнообразнее всего представлены рода Echinorhynchus – 7видов; Corynosoma – 5 и Neoechinorhynchus – 4. В восточной части моря (побережье Японских островов, юго–западная часть о. Сахалин) 68 видов, 3 отряда, 9 семейств, 23 рода (среди которых больше всего видов относятся к родам Rhadinorhynchus – 10; Acanthocephalus – 7 и Neoechinorhynchus – 7). Впервые у морских, проходных и полупроходных рыб Японского моря отмечаются: Acanthogyrus (Acanthosentis) lizae, Echinorhynchus yamagutii, Rhadinorhynchus cololabis, Andracantha mergi larvae и Corynosoma validum larvae .

Из всех исследованных семейств рыб, наибольшее число видов колючеголовых отмечено у камбаловых (13) и тресковых (12) (таб.). Самыми распространенными видами акантоцефал являются Echinorhynchus gadi (встречен у рыб 11 семейств), E. cotti (у 8), Bolbosoma caenoforme l. (у 7) и Corynosoma strumosum l. (у 11). Донные и придонные рыбы сильнее были поражены видами E. gadi, E .

cotti и C. strumosum l. Эти же виды оказались общими для 3 изученных экологических групп рыб. Только донные рыбы были поражены скребнями Metacanthocephalus ovicephalus, M. pleuronichthydis и Metacanthocephaloides zebrini, а полупроходные – Acanthosentis lizae, Neoechinorhynchus rutili, N. tylosuri и N .

agilis .

–  –  –

МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЙ АНАЛИЗ

РЕЦИДИВНЫХ ЭХИНОКОККОВЫХ КИСТ

Нартайлаков М.А., Лукманов М.И., Ахтариева А.А., Камалова А.А., Лукманова Г.И .

–  –  –

В настоящее время значительные успехи достигнуты в диагностике цистного эхинококкоза печени (ЦЭП), совершенствуется оперативная техника, однако, остается проблемой высокий процент рецидивов заболевания (Ахмедов и др., 2014). Цель исследования: изучение рецидивных эхинококковых кист для обнаружения генетических различий между первичной и рецидивной кистами .

Материал и методы. Для исследований брали стенку эхинококковых пузырей, выделенных во время оперативного вмешательства по поводу ЦЭП у 8 пациентов, обратившихся на лечение в гастрохирургическое отделение Республиканской клинической больницы имени Г.Г. Куватова (РКБ) г. Уфы .

Из фрагментов герминативной оболочки кисты эхинококка выделяли ДНК стандартным фенол-хлороформным методом (Sambrook et al., 1987). Маркерные участки ДНК для типирования E. granulosus получали методом полимеразной цепной реакции (ПЦР) синтеза ДНК и с учетом рекомендаций по способу выявления внутривидового ДНК-полиморфизма (Буйдаков и др., 2010;

Bowles et al., 1992). В качестве ДНК маркера использовали полиморфизм фрагмента митохондриального гена cox1 E. granulosus. Использовали последовательно праймеры №1: 5– TTTTTTGGGCATCCTGAGGTTTAT– 3 (прямой);

5– TAAAGAAAGAACATAATGAAAATG– 3 (обратный) и праймеры №2: 5 TGTGTTGATTTTGCCTGG 3 (прямой); 5 GCCACCACAAACCAAGTATC 3 (обратный) для разделении генотипов E. granulosus на варианты: «нормальный» и «делеционный», которые обусловлены разной длиной маркерного фрагмента гена cox1 (Буйдаков и др., 2010; Bowles et al., 1992) .

Результаты и обсуждение. Анализ фрагментов оболочки эхинококковых кист на паразитоскопическое исследование показал, что все кисты фертильны, в полости кист находились зрелые протосколексы. Микробиологическое исследование полости кист не выявило присоединения вторичной бактериальной флоры. Микроскопия хитиновой оболочки кисты, ее герминативного слоя, а также данные литературы об эпидемиологии эхинококкоза (Konyaev et al., 2013), позволили отнести взятые на исследование кисты к виду E .

granulosus с генотипом G1. Поэтому для молекулярно-генетических исследований всех кист были использованы соответствующие для этого генотипа праймеры. После применения в ПЦР праймеров №1 получены амплифицированные фрагменты ДНК от семи образцов эхинококковых кист. Далее эти семь образцов подвергли ПЦР, используя праймеры №2, и на электрофореграмме визуализировали амплификаты ДНК только от пяти образцов. Следовательно, эти пять кист имели «нормальный» генотип, а остальные два – «делеционный». Таким образом, среди исследуемых образцов было не менее двух генетически полиморфных вариантов E. granulosus: с «нормальным» и «делеционным» генотипом .

У одного из обследуемых пациентов через 2 года развился РЭП в правой доле печени (сегмента VI), размерами 4535 мм (у этого пациента первичный эхинококковый пузырь, размерами 8561 мм, находился в VIII сегменте правой доли печени и имел «нормальный» генотип). Больной оперирован, выполнена эхинококкэктомия. Взят на молекулярно-генетический анализ фрагмент герминативной оболочки рецидивной эхинококковой кисты. Проведен описанный выше способ ПЦР-анализа. Молекулярно-генетический анализ рецидивной кисты показал наличие на электрофореграмме амплифицированных фрагментов ДНК при использовании праймеров №1 и отсутствие – при использовании праймеров №2. Следовательно, рецидивная киста имела «делеционный» генотип .

Таким образом, сравнительный анализ результатов ПЦР первичной и рецидивной кист у обследуемого больного показал генетические различия. Эти данные позволяют утверждать, что рецидив не может иметь имплантационную природу происхождения, которая обусловлена диссеминацией зародышевых элементов при нарушении принципов апаразитарности во время первой операции. Поскольку рецидив развился в ранние сроки после хирургического лечения, то можно утверждать, что он имеет резидуальное происхождение .

Заключение. Сравнительный молекулярно–генетический анализ первичной и рецидивной эхинококковых кист можно использовать для дифференциации природы происхождения рецидивов ЦЭП .

Литература

Ахмедов С.М., Иброхимов Н.К., Сафаров Б.Дж. и др. Резекция печени при эхинококкозе // Анналы хирургической гепатологии. 2014. № 19(2). С. 49–54 .

Буйдаков В.М., Аслаев А.Н., Гумеров А.А., Туйгунов М.М., Лукманова Г.И. Способ идентификации генотипа G1 у изолятов Echinococcus granulosus // Медицинская паразитология и паразитарные болезни. 2010. № 1. С. 5–8 .

Bowles J., Blair D., McManus D.R. Genetic variants within the genus Echinococcus identified by mitochondrial DNA sequencing / Molecular Biochem Parasitology. 1992. Vol. 54(2) .

P.165–173 .

Konyaev S.V., Yanagida T., Nakao M. et al. Genetic diversity of Echinococcus spp. in Russia // Parasitology. 2013. Vol.140. P.1637–1647 .

Sambrook J., Fritsch E., Maniatis T. Commonly used techniques in molecular cloning .

Extraction with phenol:chloroform // Cold Spring Harbor Laboratory Press, Cold Spring Harbor. 1987. P. E3–E4 .

СОСТАВ ГЕЛЬМИНТОФАУНЫ НЕКТОННЫХ

КАЛЬМАРОВ СЕМЕЙСТВА OMMASTREPHIDAE И

ЭКОЛОГО-ЭВОЛЮЦИОННЫЕ АСПЕКТЫ ЕЕ

ФОРМИРОВАНИЯ

Нигматуллин Ч.М., Шухгалтер О.А .

ФГБНУ «Атлантический научно-исследовательский институт рыбного хозяйства и океанографии», ул. Дм. Донского, д. 5, Калининград, 236022, Россия, squid@atlantniro.ru, 8-4012-925385 Среди нектонных животных Мирового океана кальмары семейства Ommastrephidae (КО) – наиболее массовая и экологически активная группа, населяющая шельфовые, склоновые и океанические воды от Субарктики до Субантарктики при величине мгновенной общей биомассы КО ~55 млн.т. и годовом потреблении пищи ~1 млрд.т. Это консументы II–IV порядков. Их роль в трофических сетях весьма масштабна. Соответственно КО – важный компонент паразитарных систем гельминтов, использующих трофические сети для реализации своих жизненных циклов. Цель сообщения – обобщение имеющихся данных о составе гельминтофауны КО и эколого–эволюционных аспектах ее формирования .

Материал и методы. Материал включает результаты полного гельминтологического анализа 14 видов КО (2758 экз.), собранных в 1971–2000 гг. с большей части акватории Мирового океана. Привлечены также литературные данные о гельминтофауне четырех видов: Illex coindetii, Illex illecebrosus, Todarodes pacificus и северопацифических Ommastrephes bartramii (Hochberg, 1990; Bower, Margolis, 1991; Pascual et al., 1996). Экологическая классификация гельминтов проводилась на основе сведений о принадлежности к данной жизненной форме большинства видов хозяев .

Результаты. У КО отмечены около 35 личиночных форм (ЛФ) и видов гельминтов, из которых почти половина встречаются очень редко и единично, они могут быть отнесены к случайным находкам (табл. 1). Основу составляют 19 ЛФ, среди которых наибольшее разнообразие отмечается у цестод (11) и нематод (5), значительно беднее фауна трематод (3). Почти все гельминты паразитируют у КО на личиночных стадиях развития. По морфологическим признакам с использованием светооптической микроскопии эти гельминты достоверно идентифицированы только до условных «ЛФ» на уровне рода или даже семейства и представляют собой комплекс близкородственных родов-видов. У личинок цестод рода Phyllobothrium, паразитирующих у кальмаров, выделены четыре морфотипа, под видом Scolex pleuronectis объединена большая группа личиночных форм цестод сем Tetraphyllidea incertae sedis .

Дидимозоидные трематоды представлены метацеркариями трех морфотипов Monilicaecum, Torticaecum и Paramonilicaecum. Нематоды также представлены личиночными формами, идентифицированными либо до сборных видов как Anisalis simplex sensu lato или родов Contracaecum и Porrocaecum .

Выделены три экологические группы гельминтов КО: прибрежная (П) – с шельфовыми и склоновыми видами хозяев; прибрежно-океаническая (ПО)

– с близкой вероятностью паразитируют у шельфовых, склоновых и океанических животных; океаническая (О) – с океаническими хозяевами. По видовому разнообразию наиболее представительны группы ПО и О (9 и 7 видов и ЛФ), и наиболее бедная группа П (3). Для каждой экогруппы по уровням зараженности выделены характерные виды гельминтов (табл. 1). У трех жизненных форм КО выявлены различия в качественном и количественном составе видов и ЛФ гельминтов (табл. 1, 2). В целом наиболее богатая фауна гельминтов характерна для крупных океанических видов КО, для них отмечаются и максимальные уровни зараженности .

Обсуждение. Гельминтофауна КО носит вторичный, личиночный и «рыбий» облик при отсутствии специфичных гельминтов. Практически все гельминты КО благодаря широкой гостальной специфичности паразитируют на тех же стадиях онтогенетического развития у различных костистых рыб и беспозвоночных. Они реализуют свои жизненные циклы по трофическим сетям. КО для них – транспортные, как правило, экологически обязательные хозяева. При формировании семейства в юре – раннем меле исходным биотопом была зона кромки шельфа .

В эволюции КО экологическая экспансия шла от прибрежья в открытый океан и совпадает с последовательностью жизненных форм 1–2–3 (табл. 2) .

Проникновение КО в океанскую пелагиаль произошло в олигоцене-миоцене. В историческом аспекте отношения КО и их гельминтов – конвергентные. Они сформировались параллельно с трофическими связями и благодаря Таблица 1. Распределение гельминтов кальмаров по эколого-фаунистическим комплексам

–  –  –

им. «Освоение» КО именно данными гельминтами было обусловлено: а) реализацией их жизненных циклов по трофическим каналам организации сообществ; б) включением высокочисленных КО в трофические сети, в частности, в качестве важной пищи высших хищников (тунцов, ксифоидных рыб, акул и китообразных) – окончательных хозяев выявленных у КО гельминтов .

Литература Bower S.M., Margolis L. 1991. Potential use of helminth parasites in stock identification of flying squid, Ommastrephes bartramii, in the North Pacific waters // Can. J. Zool., 1991 .

Vol. 69. P. 1124–1126 .

Hochberg F.G.1990. Diseases of Mollusca: Cephalopoda // Kinne O. (ed.), Diseases of marine animals. Vol. III. Cephalopoda to Urochordata. P. 47–227. Biologisches Anstalt .

Helgoland, Hamburg .

Pascual S., Gonzalez A.F., Arias C., Guerra A. Biotic relatinships of Illex coindetii and Todaropsis eblanae (Cephalopoda, Ommastrephidae) in the Northeast Atlantic: evidence from parasites // Sarsia, 1996. Vol. 81. P. 265–274 .

–  –  –

В серии блестящих работ G.A. Parker с соавторами (Parker et al., 2003–

2015) обосновали взгляд на жизненный цикл паразитических червей как на совокупность жизненных стратегий. При этом авторы оперировали сведениями о жизненных циклах преимущественно нематод на фазах тканевого паразитизма (в промежуточных и паратенических хозяевах), а также общепринятым взглядом на наличие или отсутствие развития на той или иной фазе жизненного цикла. Используя предложенный ими подход и имеющиеся сведения о морфологии отношений скребней и цестод с их хозяевами, мы предприняли попытку определить структурные особенности жизненных стратегий гельминтов (на примере этих гельминтов) на стадиях тканевого паразитизма .

Отсутствие пищеварительных ферментов и, зачастую, механических факторов в условиях тканевого паразитизма «компенсируется» клеточным ответом организма хозяина на инвазию, вероятно, даже более жестким, чем получаемый гельминтами при обитании их в его пищеварительном тракте. Защищаясь, паразит задействует как собственные ресурсы (образование цист, формирование мощного слоя гликокаликса), так и стимулирует изоляцию себя капсулой из клеток хозяина. Первые механизмы выполняют сугубо защитную функцию, инкапсуляция же создает относительно безопасные условия жизни при сохранении гарантированного притока ресурсов хозяина (оккупация капсулы кровеносными сосудами (Березанцев и др., 1989)). В разных случаях эти механизмы используются либо «полным комплектом» либо частично, что может являться отражением степени сбалансированности возникающих отношений. Фазы цикла в промежуточном и паратеническом хозяевах рассматриваются как самостоятельные жизненные стратегии, причем вторая из них в определенной степени сравнивается с фазой во втором промежуточном хозяине (Parker et al, 2009). Однако и в случаях с цестодами во втором промежуточном хозяине и в случаях со скребнями в паратеническом морфология их взаимоотношений являет ряд особенностей, различающихся в зависимости от видовой принадлежности хозяина. В первом случае эта зависимость была продемонстрирована на примере строения капсул, окружающих дифиллоботриид двух видов в разных хозяевах (Пронина, Пронин, 1988), что позволило авторам сделать вывод о различиях в степени сбалансированности той или иной конкретной системы паразит-хозяин. Столь же ярко выраженные особенности в строении капсул, зависящие от вида хозяина и предположительно также отражающие степень сбалансированности той или иной системы, были описаны у скребней Corynosoma strumosum (Скоробрехова, Никишин, 2013). Следует подчеркнуть, что в обоих примерах, несмотря на различия в морфологии взаимоотношений, которые нередко могут выглядеть весьма «конфликтно», хозяева являются «обычными», а паразиты в них неопределенно долго сохраняют жизнеспособность. Можно предполагать, что эти особенности, если и не являются морфологическим выражением специфичности отношений, то, как минимум, соответствуют ее определенной степени. Специфическое строение капсул, окружающих личинок разных видов нематод и цестод в разных хозяевах, уже отмечалось (Березанцев, 1963), хотя понимание специфичности в последнем случае отличается от нашего .

Однако, как было показано на примере скребней в паратенических хозяевах, морфологические вариации во взаимоотношениях паразита с тканями хозяина не исчерпываются разнообразием строения капсул в хозяевах разных видов. В частности, обнаружено, что скребень в одних паратенических хозяевах покрывается толстым слоем гликокаликса, а в других нет. Причем гликокаликс образуется вне зависимости от строения капсулы, окружающей коринозому, но, повторим, только в хозяевах определенных видов. Процесс его образования краток, и в эксперименте он наблюдался уже у трехдневных скребней. Этот факт в совокупности с особенностями инкапсуляции в разных хозяевах предполагает наличие, как минимум, двух стратегий взаимоотношений коринозом с паратеническими хозяевами. Кроме того, морфологически сходный гликокаликс ранее был обнаружен на поверхности метасомы сформированных цистакантов, цисты цистицеркоидов гименолепидатных цестод, а также у некоторых ленточных форм цестод, паразитирующих в тканях (см. обзоры Никишин, 2016, 2018). Предполагается, что образование столь мощного слоя гликокаликса обусловлено одной из его основных функций – защитой от клеточного ответа хозяина .

Таким образом, проведенный анализ позволяет сделать следующие выводы. Во-первых, в случаях тканевого паразитизма паразит вынужден вырабатывать дополнительные механизмы защиты от жесткого негативного ответа хозяина. Из известных на сегодняшний день к числу таковых относятся цисты и утолщенный слой гликокаликса, но, по-видимому, существуют и другие, возможно, морфологически выраженные менее ярко. Во-вторых, морфологическое разнообразие взаимоотношений скребней с тканями паратенического хозяина позволяет предполагать наличие как минимум двух форм таких взаимоотношений и, соответственно, двух жизненных стратегий, реализуемых в зависимости от вида хозяина, в которого попадает скребень. Отсюда следует, что (в-третьих) в некоторых случаях та или иная фаза жизненного цикла (по Паркеру с соавторами – жизненная стратегия) в свою очередь может включать в себя несколько разных жизненных стратегий. Будущие исследования должны подтвердить или опровергнуть возможность применения этой гипотезы к другим группам паразитических червей .

Литература

Березанцев Ю.А. Специфичность инкапсуляции личинок паразитических нематод и цестод в тканях позвоночных // Материалы научной конференции ВОГ. 1963. С .

35–36 .

Березанцев Ю.А., Борщуков Д.В., Оксов И.В., Чеснокова М.В. Инкапсуляция личинок паразитических нематод и цестод в тканях позвоночных как форма взаимоотношений паразита и хозяина // Паразитол. сб. Т. 36. Л.: Наука, 1989. С. 131–160 .

Никишин В.П. Морфофункциональное разнообразие гликокаликса у ленточных червей // Успехи современной биологии. 2016. Т. 136, № 5. С. 506–526 .

Никишин В.П. Модификации гликокаликса скребней // Известия РАН. Серия биологическая. 2018. № 1. С. 42–54 .

Пронина С.В., Пронин Н.М. Взаимоотношения в системах гельминты–рыбы (на тканевом, органном и организменном уровнях). М.: Наука, 1988. 176 с .

Скоробрехова Е.М., Никишин В.П. Зависимость строения капсулы, окружающей скребня Corynosoma strumosum, от видовой принадлежности паратенического хозяина // Известия РАН. Серия биологическая. 2013. № 6. С. 696–712 .

Parker G.A., Ball M.A., Chubb J.C. To grow or not to grow? Intermediate and paratenic hosts as helminth life cycle strategies // Journal of Theoretical Biology. 2009. Vol. 258 .

P. 135–147 .

–  –  –

ИБ КарНЦ РАН, 185910, Петрозаводск, Пушкинская ул., 11, Россия; nikonnira@mail.ru Кижский шхерный район находится в северо–западной части Онежского озера (Южная Карелия). В его состав входит несколько больших островов Большой Клименецкий, Леликовский (1800), Кижи (203), Волкостров (198 га), и множество маленьких островков площадью менее 20 га (Бюллетень..., 2009) .

Всего на островах и части материка архипелага отмечено 8 видов мелких млекопитающих: обыкновенная, малая и равнозубая бурозубки, кутора водяная, рыжая полёвка, темная полевка, мышовка лесная и мышь–малютка (Бюллетень…, 2008). Вследствие высокой численности и широкого распространения обыкновенная бурозубка Sorex araneus является удобным объектом для изучения различных экологических аспектов паразито–хозяинных отношений. Целью данного исследования стало изучение особенностей гельминтофауны островных популяций обыкновенной бурозубки .

Исследования проводились в августе 2017 года. Отловы мелких млекопитающих выполнялись линиями ловушек Геро. Методом полного гельминтологического вскрытия было обследовано 49 особей S. araneus, отловленных на островах Большой Леликовский, Ламбинский, Малый Леликовский, Малый Ламбинский, Сато, Мяль, Колгостров, Ерницкий и Северный Олений .

Видовой состав гельминтов S. araneus представлен 18 видами (табл.), относящихся к трём систематическим группам – трематоды (2), цестоды (7) и нематоды (9 видов). Трематоды представлены семействами Brachylaemidae (Brachylaemus fulvus) и Omphalometridae (Rubenstrema exasperatum), цестоды

– семействами: Hymenolepididae (Ditestolepis diaphana, Neoskriabinolepis schaldybini, Staphylocystis furcatа, Vigisolepis spinulosa, Lineolepis scutigera) и Dilepididae (Dilepis undula, Monocercus arionis), нематоды представлены 5 семействами: Capillariidae (Aonchotheca kutori, Aonchotheca incrassata, Eucoleus oesophagicola, Calodium soricicola), Strongyloididae (Parastrongyloides winchesi), Heligmosomidae (Longistriata codrus, Longistriata didas), Anisakidae (Porrocaecum depressum), Filaroididae (Stefanskostrongylus soricis) .

Наибольшее видовое разнообразие гельминтов (9 видов) отмечено на острове Ламбинский, среди которых 3 вида цестод, 5 нематод и 1 трематода. На всех исследованных островах были обнаружены цестоды Monocercus arionis и нематоды рода Longistriata. Самые высокие значения экстенсивности и интенсивности инвазии отмечены у Longistriata didas (ЭИ=72%) и Longistriata codrus (ЭИ=68%), Monocercus arionis (ЭИ=63%) и Ditestolepis diaphana (табл.) .

Нематоды Eucoleus oesophagicola, Calodium soricicola, Porrocaecum depressum, цестоды Lineolepis scutigera и Dilepis undula были отмечены единично. Анализ сообществ гельминтов обыкновенной бурозубки, выполненный для островов, где выборка животных была более 10 особей (Большой Леликовский, Таблица. Гельминты Sorex araneus в районе Кижского архипелага

–  –  –

Ламбинский, Малый Леликовский), показал относительно высокое сходство видового состава .

Финансовое обеспечение исследований осуществлялось из средств федерального бюджета на выполнение государственного задания КарНЦ РАН (№ 0221-2017-0042) .

–  –  –

Аниканова В.С., Бугмырин С.В., Иешко Е.П. Методы сбора и изучения гельминтов мелких млекопитающих: учеб. пособие. Петрозаводск: Карельский научный центр,

2007.145 с Бюллетень экологических исследований на территории музея заповедника «Кижи»

за 2008 год / ред. сост.: Р.С. Мартьянов, Е.П. Иешко. Петрозаводск: изд-во Музей заповедник «Кижи», 2009. 24 с .

Бюллетень экологических исследований на территории музея заповедника / Экологическая тропа острова Кижи. Сост. Ю.Г. Протасов, Р.С. Мартьянов, А.В. Коросов .

Музей–заповедник «Кижи». Петрозаводск. 2008. 12 с .

–  –  –

Институт зоологии НЦЗГ НАН РА, 0014, г. Ереван, ул. П. Севака, 7, Армения Река Раздан – крупный приток реки Аракс, одна из основных водных артерий Армении, имеющая важное хозяйственное и рекреационное значение, вытекающая из оз. Севан – крупнейшего пресноводного водоема Кавказского региона, высокогорного олиготрофного озера, лежащего на высоте 1900 м .

Ихтиофауна р. Раздан в разных участках различна. В нижнем течении она представлена более чем 30-ю видами, в том числе серебряный карась, восточная быстрянка, куринский усач, севанская храмуля, ангорский голец, армянская плотва, куринская уклейка, кавказский голавль, чернобровка, верховка, бычок, гамбузия и др. Выше по течению видовой состав рыб сокращается: в верхнем течении реки регистрируются только восточная быстрянка, серебряный карась, севанская храмуля, куринский усач, ангорский голец (Пипоян, 2012) .

Гельминтофауна рыб р. Раздан почти не изучена, имеются единичные данные 1980-х гг.: при обследовании 22-x экз. карасей в хрусталиках глаз были обнаружены метацеркарии диплостом с инвазированностью до 100%, в полости тела – плероцеркоиды лигул, в кишечнике – ботриоцефалы (Вартанян, 1993) .

Изучение видового состава гельминтов рыб р. Раздан представляет научный и практический интерес, особенно ввиду усиления антропогенного пресса в данном регионе за последние десятилетия .

Целью настоящей работы являлось выявление ихтиогельминтофауны верхнего течения реки Раздан .

Материал и методы. Исследования проводили в 2016 г. Из верхнего течения р. Раздан и близлежащего канала по методике паразитологических вскрытий рыб (Быховская-Павловская, 1985) всего было обследовано 104 экз .

6-ти видов рыб из семейств Cyprinidae и Balitoridae: восточная быстрянка (Alburnoides bipunctatus eichwaldi) – 32 экз., серебряный карась (Carassius auratus gibelio) – 28 экз., севанская храмуля (Capoeta capoeta sevangi) – 16 экз., куринский усач (Barbus lacerta cyri) – 12 экз., карп (Cyprinus carpio) – 10 экз., ангорский голец (Nemachilus angorae) – 6 экз. Сбор и камеральную обработку гельминтов проводили по общепринятой методике (Быховская-Павловская, 1985), определение видов – по Определителю (Определитель паразитов пресноводных рыб фауны СССР, 1987). Для количественной характеристики популяций гельминтов использовали общепринятые показатели экстенсивности инвазии (ЭИ) и интенсивности инвазии (ИИ) .

Результаты. Из обследованных 104-х экз. рыб гельминтами инвазировано 37% (38 экз.). Зарегистрировано 8 видов гельминтов, принадлежащих к 4м систематическим группам: Monogenea – Dactylogyrus sp.; Trematoda – Diplostomum spathaceum Rudolphi, 1819, D. rutili Razmashkin, 1969, D. mergi Dubois, 1932, D. paraspathaceum Shigin, 1965; Cestoda – Ligula intestinalis (L., 1758), Bothriocephalus opsariichthydis Yamaguti, 1934; Nematoda – Rhabdochona macrostoma Moravec & Mikailov, 1970. Они были локализованы на жабрах, в хрусталиках глаз, полости тела и кишечнике рыб соответственно .

У армянской быстрянки обнаружено 3 вида гельминтов. В хрусталиках глаз зарегистрированы метацеркарии трематод Diplostomum spathaceum и D .

rutili, ЭИ = 25%, ИИ – 1–2 экз. На жабрах найдены единичные экземпляры моногеней Dactylogyrus sp., ЭИ = 12.5%, ИИ – 1 экз. У серебряного карася обнаружено 4 вида гельминтов. В хрусталиках глаз зарегистрированы метацеркарии трематод D. spathaceum, D. mergi, D. paraspathaceum, ЭИ = 29%, ИИ – 1–2 экз. В полости тела найдены плероцеркоиды ремнеца Ligula intestinalis, ЭИ = 7%, ИИ ср. – 2 экз. У севанской храмули выявлено 5 видов гельминтов. На жабрах обнаружены моногенеи Dactylogyrus sp., ЭИ = 25%, ИИ – 1 экз. В хрусталиках найдены метацеркарии трематод Diplostomum spathaceum, ЭИ = 6.2%, ИИ ср. – 2 экз. В кишечнике зарегистрирована цестодa Bothriocephalus opsariichthydis, ЭИ = 6.2%, ИИ – 1–2 экз. В полости тела обнаружены плероцеркоиды цестоды Ligula intestinalis, ЭИ = 6.2%, ИИ –1 экз. В кишечнике храмуль выявлена нематодa Rhabdochona macrostoma, ЭИ = 12.5%, ИИ – 1 экз. В хрусталиках глаз карпов обнаружено 2 вида метацеркариев диплостом – D. spathaceum и D. rutili, ЭИ = 30%, ИИ – 1–2 экз. У куринского усача выявлен 1 вид – метацеркарии трематод D. spathaceum, Э =25%, ИИ – 1 экз. (см. табл.) .

Таблица. Инвазированность обследованных рыб гельминтами

–  –  –

Nematoda Rhabdochona macrostoma храмуля кишечник 12.5 1 Обсуждение. Общая инвазированность обследованных рыб гельминтами составила 37%. В результате вскрытий выявлено 8 видов гельминтов. В фауне гельминтов рыб доминируют биогельминты – 7 видов, 1 вид – геогельминт (Dactylogyrus sp.). Пять видов гельминтов являются генералистами (кроме Dactylogyrus sp., Bothriocephalus opsariichthydis и Rhabdochona macrostoma) .

По данным гидробиологических исследований реки, при сравнительном анализе состава бентофауны реки в 1930-х гг. и в 2010–2011 гг. выявлено, что произошли изменения ее состава. В частности, моллюски сем. Lymnaeidae, являющиеся промежуточными хозяевами диплостом, обнаружены как в те годы, так и в настоящее время, однако численность их значительно уменьшилась (Даллакян, 2011). По всей вероятности, этим объясняется снижение ЭИ рыб метацеркариями диплостом, ранее доходившей до 100% .

Заключение. Гельминтофауна обследованных рыб верхнего течения реки Раздан не отличается богатым разнообразием, как и видовой состав ихтиофауны. Обедненность видового состава гельминтов рыб является, очевидно, следствием воздействия негативных антропогенных факторов: строительство водохранилищ, поступление в реку сточных вод и т.д., приводящих к изменениям состава кормовой базы рыб, численности промежуточных хозяев гельминтов и др .

Литература

Быховская-Павловская И.Е. Паразиты рыб. Руководство по изучению. 1985. 121с .

Вартанян Л.К. Паразитофауна рыб озера Севан и некоторых других водоемов и водотоков Армении / Автореф. канд. дисс., Ереван, 1993. 22 c .

Даллакян М.Р. Изменения донной фауны реки Раздан в условиях антропогенного воздействия / Автореф. канд. дисс., Ереван, 2011. 23с .

Определитель паразитов пресноводных рыб фауны СССР. 1987. Т. 3. 583 с .

Пипоян С.Х. Ихтиофауна Армении. 2012. 538 с .

–  –  –

Национальный исследовательcкий Томский государственный университет, 634050, г. Томск, пр. Ленина, 36, Россия, nvostrov@mail.ru Микроспоридии рода Nosema – один из наиболее опасных паразитов медоносной пчелы, вызывающих нозематоз. У медоносных пчел выявлено три вида микроспоридий: Nosema apis (Zander, 1909), Nosema ceranae (Fries et. al.,

1996) и Nosema neumanni Chemurot et. al., 2017. Результаты многочисленных исследований указывают на влияние климатических факторов на распространение и вирулентность микроспоридии N. ceranae на пасеках в Европе .

N. ceranae рассматривается как высоко патогенный возбудитель, вызывающий массовую гибелью пчелиных семей в некоторых регионах Европы, прежде всего, в странах с теплым климатом (в Испании, Италии, Греции, Турции и др.). Предполагается, что на данных территориях вид N. ceranae вытесняет другого паразита – N. apis (Klee et al., 2007). В странах Северной Европы (в Ирландии, Швеции, Норвегии, Германии), характеризующихся умеренным климатом, гибель пчелиных семей, вероятно, не связана N. ceranae (Gisder et al., 2017). В более холодном климате наиболее распространенным паразитом остается N. apis (Natsopoulou et al., 2015). Однако распространенность N. ceranae в более суровых природно-климатических условиях континентальных регионов Северной Азии практически не изучалась .

Ранее (Островерхова и др., 2016, 2018) в результате ретроспективного диагностического молекулярно-генетического исследования установлено, что возбудитель N. ceranae присутствовал в пчелиных семьях на пасеках разных районов Томской области (в том числе и северных) как минимум начиная с 2009 года (образцы были доступы с 2008 года). Кроме того, неожиданным было выявление нозематоза (обоих возбудителей с преобладанием N. ceranae) в большинстве исследованных семей на двух изолированных пасеках Красноярского края, куда не завозились новые пчелиные семьи в течение более 50 лет. Эти данные позволяют предположить, что отношения медоносная пчела–микроспоридия N. ceranae могли возникнуть значительно раньше, чем принято считать (впервые вид N. ceranae выявлен у медоносной пчелы в 1996 году), и распространенность нозематоза типа С (возбудитель N. ceranae) может быть связана не только с завозом инфицированных семей на незараженные территории, но и с естественным распространением возбудителя в природе .

Для изучения особенностей распространения двух видов Nosema нами в течение 2016–2017 гг. исследована зараженность нозематозом пчелиных семей различных географических (экологических) регионов Северной Азии Таблица 1. Распределение двух видов Nosema на пасеках различных экологических регионов Северной Азии (2016–2017 гг.)

–  –  –

(табл. 1). Изучены пасеки, расположенные в 4 экологических районах Северной Азии – южной тайге, подтайге, лесостепи и горно–таежных лесах .

На всех исследованных территориях выявлено значительное количество зараженных нозематозом пасек: от 50.0% пасек в лесостепной зоне до 74.1%

– в зоне подтайги. На пасеках всех экологических районов преобладала коинвазия (регистрировались оба возбудителя нозематоза), но представленность видов Nosema (регистрация или только возбудитель N. apis, или только N. ceranae, или совместное присутствие двух возбудителей) была различной .

Так, с одной стороны, в южной тайге выявлено примерно одинаковое число пасек с разными вариантами зараженности: 19% пасек – только с возбудителем N. apis, 19% – только с N. ceranae и 24% – ко-инвазия; с другой стороны, несмотря на разные климатические условия лесостепной зоны (континентальный климат) и горно–таежных лесов (резко континентальный климат), в этих экологических регионах распространение видов Nosema имеет сходную картину: 9–11% пасек с N. apis; 17–18% пасек с N. ceranae; 22–36% пасек с ко– инвазией. Наконец, зона подтайги резко отличается от других исследованных территорий (экологических зон): выявлено наименьшее количество пасек только с одним возбудителем N. ceranae (7.4%), но наибольшее количество пасек, на которых присутствовали оба возбудителя (48.1%); кроме того, примерно на 1/5 пасек (18.5%) присутствовал только возбудитель N. apis (ситуация сходна с зоной южной тайги) .

Таким образом, во всех изученных экологических регионах выявлены оба возбудителя нозематоза, при этом наименее зараженной территорией является лесостепь, наиболее зараженной – подтайга. Возбудитель N. ceranae наряду с N. apis широко распространен на территориях, характеризующихся суровыми климатическими условиями с продолжительной холодной зимой. Во всех экологических регионах на исследованных пасеках преобладает ко-инвазия (38.5–65.0% от числа зараженных пасек). Вытеснения паразита N. apis более патогенным возбудителем N. ceranae не наблюдается .

Очевидно, что необходимы дополнительные исследования для выяснения эффекта заражения медоносных пчел возбудителем N. ceranae на пасеках разных географических районов с учетом многолетней и сезонной динамики зараженности пчелиных семей нозематозом, взаимоотношений между патогенами при совместном заражении пчел и между патогенами и медоносной пчелой (в том числе с учетом их генетических особенностей), а также роли возбудителей нозематоза в массовой гибели пчел .

Литература

Островерхова Н.В., Конусова О.Л., Кучер А.Н. и др. Зараженность семей медоносной пчелы (Apis mellifera) микроспоридиями рода Nosema (Microsporidia) на пасеках Томской области // Паразитология. 2016. Т. 50. № 3. с. 197–210 .

Островерхова Н.В., Голубева Е.П., Бажмажапова Е.А. и др. Нозематоз типа С в Сибири: ретроспективный анализ // Пчеловодство. 2018. № 1. С. 32–34 .

Gisder S., Schler V., Horchler L.L. et. al. Long-term temporal trends of Nosema spp .

infection prevalence in Northeast Germany: continuous spread of Nosema ceranae, an emerging pathogen of honey bees (Apis mellifera), but no general replacement of Nosema apis // Front. Cell. Infect. Microbiol. 2017. V. 7. P.301 .

Klee J., Besana A.M., Genersch E. et. al. Widespread dispersal of the microsporidian Nosema ceranae, an emergent pathogen of the Western honey bee, Apis mellifera // J. Invertebr .

Pathol. 2007. V. 96. P. 1–10 .

Natsopoulou M.E., McMahon D.P., Doublet V. et. al. Interspecific competition in honeybee intracellular gut parasites is asymmetric and favours the spread of an emerging infectious disease // Proc. Biol. Sci. 2015. V. 282. P. 20141896 .

–  –  –

В работе приводятся данные экологического анализа нематодофауны куликов Ямала и побережья Обской губы. Были использованы материалы и данные полного гельминтологического вскрытия птиц, находящиеся в музее Центра паразитологии ИПЭЭ РАН. Данный материал был собран экспедициями ГЕЛАН под руководством чл.-корр. РАН М.Д. Сонина и профессора В.И .

Фрезе. Работы проводились в 1974–1975 гг. на Ямале. Определение нематод было проведено Марком Дмитриевичем Сониным Всего было обследовано методом полного гельминтологического вскрытия 1 274 кулика 21 вида. У них найдено 3 359 нематод 47 видов .

Для анализа данных мы использовали показатель – концентрация домиS нирования по Симпсону – С = p, где р – относительное обилие каждого о i =1 вида, т.е. доля каждого вида в общем количестве нематод в данной группе куликов (общее количество нематод принимается за 1) .

Важным показателем структуры сообщества является индекс видового разнообразия – d.

Мы использовали индекс разнообразия Маргалефа:

S -1 d=, где S – число видов, N – численность всех нематод. Для сравнеlog N ния, использовали информационную меру разнообразия – индекс Шеннона S H = - p i ln pi .

i =1 Сходство нематодофаун между прилетевшими на гнездовье взрослыми птицами (ad) и слетками (subad), а также между видами куликов рассчитываa ли по индексу общности Чекановского-Съёренса I =, где а – (a + b) + (a + c) число общих видов в двух сравниваемых списках; (a+b) – первый сравниваемый список видов; (a+c) – второй сравниваемый список видов .

Также использовали принятые в паразитологии показатели экстенсивность инвазии (ЭИ), интенсивность инвазии (ИИ) и индекс обилия (ИО) .

Был проведен анализ стабильности структуры сообщества нематод у кулика-воробья (Calidris minuta (Leisl.) в местах гнездовий (Обская губа). Данный вид наиболее многочисленный в наших сборах, и количество вскрытий приблизительно одинаково по годам. Сравнивались параметрические и непараметрические показатели зараженности этих куликов в 1974 и 1975 гг. (в 1974 г. было вскрыто 92 птицы – ad, а в 1975 – 101 ad.). Ранее нами (Пельгунов, 1993) было показано, что сообщество цестод куликов является постоянным и основные параметрические и непараметрические показатели из года в год повторяются. Было принципиально важным выяснить, распространяется ли этот вывод на другие группы гельминтов перелетных птиц и, в частности, нематод .

Видовой состав нематод по годам несколько различался, но все виды, экстенсивность которых превышала 3%, встречаются и в 1974 г., и в 1975 г .

Доминирующие виды одни и те же. Данные по индексу обилия и относительному обилию видов нематод по годам сравнивались по t критерию – разница статистически недостоверна, следовательно, это выборки из одной генеральной совокупности. Это было характерно также и для цестод этих куликов. Так же, как и цестоды, нематоды подчиняются математической модели распределения «геометрических рядов», предложенной Motomura (1947). Параметр геометрической прогрессии равен: для данных 1974 г.: Z = 0.42, для 1975 г.: Z = 0.55. Разница статистически незначима .

Индекс Симпсона для нематод в 1974 г. был равен 0.34, в 1975 г. – 0.28 .

Индекс Маргалефа для нематод составлял 3.45 и 3.26 (соответственно в 1974 г .

и 1975 г.). Индекс Шеннона для нематод в 1974 г. был равен 3.45, в 1975 г. – 3.26 .

Таким образом, вывод о том, что сообщество паразитов перелетных птиц является для каждой местности постоянным образованием, с предсказуемой структурой, а не является результатом случайной комбинации видов, справедливо и для цестод, и для нематод .

Из 47 видов нематод найденных у куликов только 13 зарегистрировано у слетков. 26 видов нематод зарегистрировано только у одного хозяина, из них 3 вида нематод найдено у взрослых птиц и слетков. Остальные 20 видов нематод зарегистрированы у двух и более хозяев. Нематода Tetrameres dubia Travassos, 1917 зарегистрирована у 9 видов куликов, включая взрослых птиц и слетков .

Необходимо отметить, что 7 видов нематод, зарегистрированных у 1 хозяина, были найдены у нескольких птиц этого вида. Syngamus palustris Ryjikov, 1949 найден у турухтанов у 24 ad и 24 subad .

Максимальное количество видов нематод зарегистрировано у галстучника (Charadrius hiaticola L., 1758) ad – 15 .

Орнитологи среди куликов выделяют несколько трофических групп (Бондаренко, 1971; Юдин, 1965). Для сравнения мы взяли 10 видов куликов, обследованных в статистически значимых количествах .

1. «Сухопутные» кулики – Ржанка золотистая (Pluvialis apriaria L., 1758) ad: ЭИ = 96.7%±3.3%; ИИ = 9.7 (1–63)±2.19; ИО = 9.4±2.14; (N) количество видов нематод – 11, d = 2.94 .

2. Вылавливающие корм из воды, не связанные с грунтом – Круглоносый плавунчик (Phalaropus lobatus L., 1758) ad: ЭИ = 12.3%±3.1%; ИИ = 2.0(1– 7)±0.48; ИО = 0.2±0.08; (N) количество видов нематод – 4, d=0,84 .

Индекс сходства I = 0.13 .

Видно, какая значительная разница в заражении нематодами у этих куликов, обитающих в одной и той же местности. Это характерно практически для всех трофических групп куликов .

Наибольшее сходство нематодофауны наблюдается между турухтаном (Philomachus pugnax L., 1758) и ржанкой золотистой I = 0.40; турухтан и галстучник (Charadrius hiaticola L., 1758) I = 0.41 .

Между остальными видами куликов (включая представителей одного и того же рода) индекс сходства редко превышает 0.20. Это объясняется очень разнообразным и специфическим способом добычи корма .

Еще больше разница в заражении нематодами у птиц, прилетевших на гнездовье (ad) и слетками (subad) .

1. Галстучник ad: ЭИ = 45.5%±5.0%; ИИ = 7.4(1–121)±2.85; ИО = 3.4±1.34;

N = 15. Subad: ЭИ = 6.7%±3.2%; ИИ = 1.2(1–2)±0.25; ИО = 0.1±0.04; N = 2 .

2. Мородунка (Xenus cinereus (Guldenstadt, 1775) ad: ЭИ = 92.8%±4.0%;

ИИ = 3.3(1–15)±0.37; ИО = 10.6±3.0; N = 10. Subad: ЭИ = 16.7%±10.8%; найдено 2 Nem., N = 1 .

3. Кулик-воробей (Calidris minuta Leister, 1812) ad: ЭИ = 51.0%±3.6%; ИИ = 4.0(1–40)±0.35; ИО = 2.0±0.23; N = 9. Subad: ЭИ = 6.7%±3.2%; ИИ = 2.2(1– 4)±0.63; ИО = 0.1±0.08; N = 2 .

Все это дает возможность предположить, что основное ядро нематодофауны куликов формируется на юге, в основном в местах зимовок .

Работа выполнена при поддержке программы Президиума РАН № 41 «Биоразнообразие природных систем и биологические ресурсы России»

УЧЁТ ПАРАЗИТАРНОГО ЗАГРЯЗНЕНИЯ ПОЧВ В

ФОРМАТЕ ВНЕДРЕНИЯ АЛСЗ (АДАПТИВНОЛАНДШАФТНЫХ СИСТЕМ ЗЕМЛЕДЕЛИЯ)

Перевертин1 К.А., Козлов2 Д.Н .

Центр паразитологии ФГБНУ Институт проблем экологии и эволюции им. А.Н. Северцова РАН, 119071, Москва, Ленинский пр., 33, Россия; perevertink@mail.ru;

Почвенный институт им. В.В. Докучаева, 119017, М. Пыжевский пер.7 стр. 2

–  –  –

Переход от оценки фитосанитарного состояния почв к агроэкологической оценке земель (и выше – агроландшафтов), по определению, требует если не единого, то согласованного (непротиворечивого) междисциплинарного подхода для почвоведения, защиты растений и паразитологии .

В 1994 г. профессорами М.Д. Сониным, С.А. Беэром и В.А Ройтманом был предложен и активно вводился термин «паразитарное загрязнение (ПЗ)»

для любых экосистем, в частности, реализовывалась программа по изучению ПЗ мегаполиса Москвы (Перевертин, 1994). В настоящее время поисковые системы Интернета на запрос parasitic contamination of soil адресуются к работам, в основном, посвящённым почвообитающим стадиям паразитов человека и животных .

Однако в русле современных концепций природопользования, безусловно, основным объектом агроэкологической оценки земель являются почвенные агробиоценозы с обязательным учётом фитосанитарной составляющей .

Нами предлагается следующее определение:

Паразитарное загрязнение почв – вид деградации ландшафтов с необратимым присутствием популяций почвообитающих паразитов (вредных организмов), имеющих вредоносность выше фоновой .

1. Необратимость – важнейший, на наш взгляд, признак, переводящий вредный организм из широкого спектра объектов защиты растений в категорию безусловной характеристики почвенной деградации (или неотъемлемый элемент агроэкологической оценки земель) .

2. Фоновая вредоносность вредного организма (Перевертин, Заец, 2015)

– характеристика, как правило, естественных ценозов, как результат сложившихся в результате коэволюции устойчивых хозяинно-паразитных отношений в очагах происхождения ИЛИ статичная невыраженность агрессивности (латентность) со стороны повсеместно распространённых вредных организмов (географических убиквистов или космополитов) по отношению к культивируемому растению-хозяину .

Методика геометрической стратификации. Метод геометрической стратификации вполне корреспондируется с методикой ландшафтного анализа в области определения элементарных ареалов агроландшафта (ЭАА). Задача стратификации – выделение на картограмме элементарных контуров, каждый из которых обладает уникальным (не совпадающим с другими контурами) набором оцениваемых параметров Число оцениваемых параметров (например, микрорельеф, механический состав, контуры очагов нематодного заражения, иные почвенные разности) зависит от уровня интенсификации производства. Однако в данной работе нетрадиционно используется метод геометрической стратификации для анализа междисциплинарных связей научных специальностей .

На рис.1. научные дисциплины Почвоведение (код специальности – 03.02.13), Защита растений (06.02.01), Паразитология (03.02.11) представлены в виде кругов – I, II, III. При пересечении кругов линии их ок- Рис. 1. Применение метода геометрической ружностей считаются равноценны- стратификации для выделения уникальных межми и образуемые ими контуры ну- дисциплинарных контуров классификации биоты .

меруются подряд .

В нашем случае от 1 до 7. Для наглядности номер контура заключён в кружок. Традиционная арифметическая комбинаторика (число перестановок и сочетаний из n по m никогда не равно 7) неприменима. В этом специфичность геометрического подхода, который, относится к теории графов .

На этом, кстати, базируется современное Проектирование ландшафтов (Кирюшин, 2004); где в отличие от апробированной ещё в советское время практики безадресного применения задачи ЛП (линейного программирования) для оптимизации структуры посевных площадей теория АЛСЗ (адаптивно-ландшафтных систем земледелия) предполагает объективную агрогеографическую «привязку» к элементарным ареалам ландшафта с последующим оптимальным формированием производственных участков и в конечном итоге Проектов землепользования (от ландшафтного анализа к синтезу) .

Обсуждение результатов геометрической стратификации. На рисунке 2 показана подробная диаграмма междисциплинарных связей традиционного Почвоведения с Паразитологией и Защитой растений, позволяющая математически–валидно подойти к заявленному уровню (слою) классификации связанной с почвой биоты .

Заметим, что представленная диаграмма позволяет классифицировать именно биоту по 7–и контурам .

– контур 1. Условно не связанные с почвой объекты защиты растений .

Примеры саранчи и яблонной плодожорки достаточно иллюстративны .

Плодожорка действительно весьма условно связана с почвой. Зимующие стадии могут находиться в листовом опаде, но способны зимовать и в тканях коры плодовых, поддерживая популяцию. Условность связи с ландшафтом для саранчи в том, что, хотя яйца откладываются во влажную почву (там, кстати, происходят 5 линек), но удалённость не представляет возможности предРис. 2. Классификация биотической составляющей по дисциплинам .

сказуемого учёта этого безусловно фитосанитарного фактора для конкретных агробиоценозов. Хотя, в принципе, подход к рациональному природопользованию не должен быть локальным и регламенты по обработке очагов должны выполняться и в межрегиональном, и в межгосударственном формате. Весьма тревожным представляется факт, что «атаковала», например, Калмыкию в 2017 г. не азиатская саранча, а (впервые) марокканская, и не из Казахстана, а из Дагестана .

– контур 2 характеризуется вредителями связанными с почвой только зимующей стадией, такими как колорадский жук или томатная минирующая моль. Несмотря на высочайшую вредоносность и приуроченность к ограниченному кругу растений-хозяев эти объекты не являются паразитами .

– контур 3. Объекты паразитологии не связанные с почвой – например, церкарии, вызывающие «зуд ныряльщика», вирусы человека и животных, такие, как грипп птиц, африканская чума свиней и т.д .

– контур 4 объединяет связанные с почвой вредные организмы являющиеся объектом защиты растений, но не являющиеся паразитами, например, медведки. Сюда же, можно отнести и сорняки. Причём такие трудноискоренимые, как горчак ползучий, по-видимому, могут условно рассматриваться, как элемент почвенной деградации и учитываться при агроэкологической оценке почв .

– контур 5. Основной контур, полностью соответствующий данному выше определению паразитарного загрязнения почв применительно к агробиоценозам. Сюда относятся объекты необратимого паразитарного загрязнения – почвенные нематоды, в том числе вирофорные (как и сами вирусы), фитопатогенные грибы, возбудители бактериозов и пр .

– контур 6. Связанная с почвой паразитарная биота, не имеющая отношения к защите растений. В первую очередь это гельминты – паразиты человека и животных, цикл развития которых частично включает и почвенную среду .

Примером может служить аскарида человеческая. Сюда же относятся такие опасные обитатели почв, как клостридии ботулизма, возбудители столбняка и сибирской язвы. На рис. 2. этот контур вырезан и не будет рассматриваться в рамках агроэкологической оценки почв .

– контур 7. Этот контур включает почвенную биоту хорошо изученную в рамках традиционного почвоведения — микробную биомассу, а также другие организмы, по меньшей мере, не отнесённые к вредным. Заметим, что сюда же нами причисляются и биологические антагонисты вредных организмов .

Таким образом, можно констатировать следующие положения:

– традиционное почвоведение, как научная дисциплина при учёте педобиоты замыкается в рамках контура 7 .

– Вполне логичным представляется учёт и «вредной» биоты (контур 5), а именно, организмов необратимо загрязняющих почву, само присутствие которых, независимо от плотности популяции является неотъемлемой характеристикой почв, как одна из форм почвенной деградации .

– Однако для агроэкологической оценки земель в рамках сельскохозяйственной практики – важнейшей составляющей природопользования – представляется необходимым объединение трёх секторов – 4 (зелёный), 5 (жёлтый) и 2 (красный). Именно этот набор («светофор») соответствует практическим задачам мониторинга агроландшафтов в формате АЛСЗ (адаптивноландшафтных систем земледелия) .

Литература

Кирюшин В.И., Иванов А.Л. (редакторы) Адаптивно–ландшафтные системы земледелия Владимирского Ополья // Агроконсалт. М, 2004. 494с .

Перевертин К.А. (составитель сборника) Паразитарное загрязнение мегаполиса Москвы // ИНПа РАН. М, 1994. 65 с .

Перевертин К.А., Заец В.Г. Опасный карантинный вредитель // Картофель и овощи .

2015 .

ФОРМИРОВАНИЕ ГЕЛЬМИНТОФАУНЫ ДИКИХ

КОПЫТНЫХ НА ФОНЕ ТЕРРИТОРИАЛЬНОЙ И

ТРОФИЧЕСКОЙ КОНКУРЕНЦИИ

Полоз С.В., Лобановская П.Ю., Анисимова Е.И., Соловей О.Э., Скуратович Е.Г., Шакун В.В., Янута Г.Г., Велигуров П.А .

Государственное научно-производственное объединение «Научно-практический центр Национальной академии наук Беларуси по биоресурсам»

lana.poloz@gmail.com Структурная организация сообществ диких копытных определяет постоянство гельминтофаунистических комплексов. Изменения структуры сообществ копытных ведут к изменению паразитологической ситуации, что важно учитывать при вселении новых видов, например, зубра. Гельминты являются важнейшим и постоянно действующим фактором, влияющим на состояние популяции диких млекопитающих. Под их влиянием происходит нарушение физиологических процессов в организме диких млекопитающих, которое оказывает негативное влияние на выживаемость животных и темпы роста численности популяций. Они также снижают продуктивность этих животных, а при сочетании с другими неблагоприятными условиями могут вызвать гибель животных (Полоз, Анисимова, Юрченко, 2016) .

Материалы и методы. Отбор проб для изучения видового состава гельминтофауны диких копытных проводили на стационарных участках РЛЗ «Налибокский». При этом использовали лабораторные методы седиментации и флотации. Изучение общей инвазированности диких копытных и состава их гельминтов проводились по следующим методикам: гельминтокопроскопическое (овоскопия и лярвоскопия) – по Демидову (1987); культивирование стронгилят жвачных – по методу А.М. Петрова (Петров, Гагарин, 1953), культивирование и определение инвазионных личинок стронгилят жвачных – по П.А. Полякову (Якубовский, Карасев, 2001; Капустин,1953), гельминтолярвоскопические исследования – по методу Бермана (Якубовский, Карасев, 2001) .

Все рассчитанные показатели были проверены на достоверность с помощью компьютерных программ Statbiom2000 и «Достоверность», на основе компьютерной программы Microsoft Office Excel. Достоверность данных больше 95% .

Результаты и обсуждение. По результатам исследований видовой состав гельминтов диких копытных РЛЗ «Налибокский» включает 8 родов 2 классов. Представители одного рода принадлежат классу Trematoda, остальные классу Nematoda. Общая зараженность диких копытных гельминтами составила 72%. Среди всех представленных гельминтов по количеству обнаруженного в пробах инвазионного материала преобладал вид Neoascaris sp. – 68%, за ним следует Dictyocaulus sp. – 66% и Strongyloides sp. – 33%. Минимальный индекс доминирования у представителей видов Paramphistomum sp., Strongylata sp. – 3% .

У зубра европейского было зарегистрировано 5 родов гельминтов, относящихся к 2 классам. Среди них чаще всего встречался род Neoascaris – 100%, он же доминировал по количеству обнаруженных яиц (68%), с интенсивностью инвазии 3–8 экземпляров. Реже встречались представители родов Trichurus, Dictyocaulus, Strongylata, Paramphistomum. Общая зараженность зубра составила 100%. У оленя благородного было выявлено 4 рода паразитических гельминтов, относящихся к классу Nematoda. Зарегистрированы моно–, ди– и триинвазии. Наибольшая экстенсивность инвазии отмечена у гельминтов родов Dictyocaulus и Protostrongylus – по 44%. По количеству зарегистрированных личинок доминирует представители рода Dictyocaulus – 32%. Наибольшая интенсивность инвазии у представителей рода Trichurus до 5 экз .

Меньше всего было найдено яиц, относящихся к роду Strongyloides – 15% от общего числа обнаруженных яиц .

Общая зараженность оленя благородного составила 67%. Отмечено, что при одинаковой высокой зараженности половозрелых самок и самцов оленя видовое разнообразие гельминтов у самок больше чем у самцов. Гельминтофауна косули включает 2 рода: Trichostrongylus и Dictyocaulus, относящиеся к подотряду Strongylata .

При изучении проб экскрементов лося было установлено, что гельминтофауна этого животного представлена 2 родами паразитов, Strongyloides и Dictyocaulus. Наибольшая встречаемость у представителей рода Dictyocaulus 50%, он же доминирует по количеству обнаруженных личинок – 66%. Экстенсивность инвазии представителей рода Strongyloides составила 25%, индекс доминирования равен 33%. Общая зараженность лося равняется 50% .

Сравнение использования общих видов древесно–кустарниковых растений (сосна, береза, крушина, рябина) позволяет оценить степень перекрывания реализованных трофических ниш зубра, лося, оленя и косули. На основе теории трофической конкуренции (Бигон, Харпер, Таунсенд, 1989) была построена модель, отражающая степень перекрывания реализованных трофических ниш зубра, лося, оленя и косули. Анализ данной модели показывает наибольшую экологическую пластичность и, следовательно, большее конкурентное преимущество имеет благородный олень. Его трофическая ниша практически полностью перекрывает таковую у косули, у которой экологическая пластичность вторая по величине. Сходные по пластичности и перекрываемости трофические ниши у зубра и лося. Однако у зубра она несколько шире, но немного больше перекрывается с благородным оленем .

Перекрывание трофических ниш, а также контакты диких копытных на подкормочных площадках и кормовых полях приводят к общности состава гельминтов, что обнаруживается при копроскопических исследованиях .

Вселение зубра приводит к резкому увеличению зараженности копытных животных (более 55–60%), а также изменению показателей общности видового состава гельминтов. Происходит увеличение общности видов гельминтов у оленя и косули (44–50%) и косули и лося (38%), в то время как общность видов гельминтов у косули и зубра составляет 27%. Это связано с тем, что зубр активно вытесняет косулю в занятые оленем благородным биотопы, что приводит к увеличению обмена паразитами между этими животными. В хоТаблица. Меры включения сообществ гельминтов копытных (Семкин, 1973)

–  –  –

зяйствах, где отсутствует зубр, максимальная общность видового состава гельминтов у оленя и косули составляет 38%, а тоже время общность видового состава этих животных с лосем не превышает 20%, что связано с обособленным образом жизни последнего. Зараженность животных менее 50% .

Заключение. В связи с созданием новых и развитием существующих популяций зубра возникает территориальная конкуренция между этим видом и копытными семейства Оленьих. Этот процесс способен влиять на развитие популяций благородного оленя и косули в местах их совместного обитания .

Полученные данные о видовом составе гельминтофауны, факторах, влияющих на ее формирование, степени зараженности гельминтами и общности видового состава копытных позволило установить значительное влияние видового разнообразия гельминтов зубра на формирование гельминтофауны других диких копытных. Дальнейшие исследования влияния территориальной интерференции копытных на формирование гельминтофауны других видов животных позволит прогнозировать появление тех или иных видов гельминтов, выделить наиболее распространенные и патогенные из них и разработать мероприятия по контролю над распространением и борьбе с ними .

Работа проводилась в рамках научных исследований БРФФИ по договору Б17- 085 .

–  –  –

Полоз С.В., Анисимова Е.И., Юрченко Д.Г. Способ коррекции патогенного влияния ассоциаций паразитов на организм млекопитающих // Теория и практика борьбы с паразитарными болезнями. 2016. С. 352–355 .

ТАКСОНОМИЧЕСКИЙ СТАТУС И МОЛЕКУЛЯРНАЯ

ХАРАКТЕРИСТИКА ЦЕСТОД РОДА

ACANTHOBOTHRIUM BLANCHARD, 1848 (CESTODA:

ONCHOPROTEOCEPHALIDEA) ОТ СКАТА DASYATIS

PASTINACA (L., 1758) В ЧЕРНОМ МОРЕ, КРЫМ Полякова1 Т.А., Слынько1 Ю.В., Слынько1,2 Е.Е., Саркисов3 Д.Г .

Институт морских биологических исследований им. А.О. Ковалевского РАН, пл. Нахимова, 2, Севастополь, 299011, Россия, polyakova-acant@yandex.ru, Институт биологии внутренних вод им. И.Д. Папанина РАН, Борок, Россия Севастопольский Государственный Университет, ул. Университетская, 33, Севастополь,

–  –  –

Цестоды рода Acanthobothrium Blanchard, 1848 являются одними из самых разнообразных и распространенных паразитов хрящевых рыб Мирового океана и в настоящее время валидными признано 188 видов (Caira et al., 2017) .

Впервые Acanthobothrium в Черном море были найдены в 1872 г. В.Н. Ульяниным у скатов Raja clavata и Dasyatis pastinaca и определены как A. coronatum (Rud., 1819) Blanchard, 1848. Однако в работе отсутствует описание этого вида .

Л. Борче (Borcea, 1934) подтвердила нахождение A. coronatum у обоих видов скатов у побережья Румынии, кроме того, впервые обнаружила A. dujardini van Beneden, 1850 у R. clavata и описала от этого хозяина новый вид A. ponticum Borcea, 1934. Позже A. ponticum был обнаружен у побережья Румынии и у другого вида скатов – D. pastinaca (Borcea, 1935). Таким образом, до наших исследований у обоих видов скатов в Черном море было известно только три вида Acanthobothrium .

В наших сборах цестод от скатов R. clavata и D. pastinaca у побережья Крыма не были обнаружены ранее отмеченные A. dujardini, A. coronatum и A .

ponticum. При изучении цестод от D. pastinaca нами впервые были обнаружены цестоды рода Acanthobothrium, которые по морфологическим особенностям относятся к видам из Категории 3, предложенной С. Гошра и Ж. Каира (Ghoshroy, Caira, 2001). В настоящее время признано 18 валидных видов цестод этого рода в Категории 3. Черноморские особи, идентифицированные нами как Acanthobothrium sp., существенно отличаются не только от видов из Категории 3, но и от всех оставшихся валидных 170 видов Acanthobothrium .

Acanthobothrium sp. наиболее близок к A. crassicolle Wedl, 1855 от ската D .

pastinaca из Средиземного моря (побережье Франции) и к A. cairae VardoZalik & Campbell, 2011 от Bathytoshia centroura из Атлантики (побережье Массачусетса), но отличается размерами червя, сколекса, длиной передней локулы, длинным головным стеблем, тотальной длиной крючьев, размером терминальных проглоттид, формой яичника и числом семенников .

Нами проанализирована изменчивость фрагментов двух генов рДНК – lsrDNA (28S) – длиной 312 п.н. и ssrDNA (18S) – 568 п.н. у черноморских особей Acanthobothrium sp. (MH01140418S; MH00037428S). Были использованы сопоставимые (по критерию идентичности нуклеотидной последовательности фрагмента) данные из NCBI по двум видам Acanthobothrium: A. mattaylori Fyler & Caira, 2010 (HQ917927[CF-31]) от акулохвостого ската Rhynchobatus laevis у северного побережья Австралии и Acanthobothrium sp. 1 Olson, Littlewood, Bray & Mariaux, 2001 (AF286953) от длиннохвостого ската Hypanus longus из Калифорнийского залива для установления того, являются ли разные виды цестод принадлежащие к одному роду, паразитирующие у хозяев, разделенных не только филогенетически, но географически, близкородственными друг другу .

Установлено, что Acanthobothruim sp., паразитирующий у ската Dasyatis pastinaca из семейства Dasyatidae в Черном море, более тесно связан (99% сходство по 28S) с A. mattaylori от Rhynchobatus laevis из семейства Rhynchobatidae и на 98% имеет сходство с Acanthobothrium sp. 1 от Hypanus longus из семейства Dasyatidae чем с сородичами, паразитирующими у скатов рода Dasyatis .

В результате проведенного исследования, общее число видов цестод рода Acanthobothrium найденных у скатов рода Dasyatis в Атлантики, в Средиземном и Черном морях доведено до шести. Проведенный нами филогенетический анализ подтвердил предыдущие молекулярные результаты (Fyler, Сaira,

2010) о том, что виды цестод одного рода, паразитирующие либо в одних и тех же видах хозяев, либо в разных видах хозяев одного рода, не являются ближайшими родственниками друг друга .

Литература

Borcea L. Note preliminaire sur les cestodes des Elasmobranches ou Sйlaciens de la Mer Noire // Annales Scientifiques de l’Universitй de. 1934. Vol. 19. P. С. 345–369 .

Borcea L. Nouvelle note sur Acanthobothrium ponticum L. Borcea (n. sp.) // Annales Scientifiques de l’Universitй de. 1935. Vol. 20. P. С. 480–481 .

Caira J.N., Jensen K., Ivanov V.A. Onchoproteocephalidea II Caira, Jensen, Waeschenbach, Olson & Littlewood, 2014. In Planetary Biodiversity Inventory (2008-2017): Tapeworms from Vertebrate Bowels of the Earth. J.N. Caira & K. Jensen (eds). University of Kansas, Natural History Museum, Special Publication, KS, USA. 2017. Vol. 25. Р. 279–304 .

Fyler C.A., Caira J.N. Phylogenetic status of four new species of Acanthobothrium (Cestoda:

Tetraphyllidea) parasitic on the wedgefish Rhynchobatus laevis (Elasmobranchii:

Rhynchobatidae): implications for interpreting host associations // Invertebrate Systematics. 2010. Vol. 24. Р. 419–433 .

Ghoshroy S., Caira J.N. Four new species of Acanthobothrium (Cestoda: Tetraphyllidea) from the whiptail stingray Dasyatis brevis in the Gulf of California, Mexico // Journal of Parasitology. 2001. Vol. 87. P. 354–372 .

–  –  –

Цестоды отряда Cyclophyllidea используют в качестве промежуточных хозяев широкий спектр беспозвоночных и позвоночных животных, которые различаются своей биологией и параметрами внутренней среды. Эти факторы, в свою очередь, обуславливают значительное морфологическое разнообразие метацестод, точнее, их защитных структур, обеспечивающих развитие в промежуточном хозяине и сохраняющих целостность дефинитивной части (сколекса и шейки) при попадании в организм окончательного хозяина .

Основными типами метацестод циклофиллидей являются цистицеркоид, цистицерк и мероцеркоид (Lenta Chervy, 2002). Из трёх упомянутых типов метацестод наиболее разнообразны цистицеркоиды, их насчитывается около десяти видов (Lenta Chervy, 2002). Среди моноцефалических цистицеркоидов на территории Магаданской области отмечены церкоциста, циклоцерк, тектациста, моноцерк, стробилоциста (стробилоцерк), различные диплоцисты и два аскоцерка – настоящий аскоцерк и мегалоцерк. Церкоцисты и диплоцисты рассмотрены как на световом, так и ультраструктурном уровнях (Caley, 1975; Бондаренко, Контримавичус, 2006; Никишин, 2010). Большое количество работ посвящено моноцеркам дилепидид, куда относится и Rauschitaenia ancora (Мамаев, 1959), цестода с нетипичным способом фиксации (заякоривание с образованием капсулы). При сравнении хоботков метацестоды и взрослой цестоды выявлена остановка развития этого органа фиксации, который у взрослой цестоды имеет размеры близкие к таковым метацестоды (Бондаренко, Томиловская, 1979). Кроме того, обнаружена выраженная клеточная реакция хозяина (энхитреиды) состоящая в формировании капсулы из целомоцитов и неклеточного материала .

Помимо этих трёх широко распространённых типов цистицеркоидов (церкоциста, диплоциста и моноцерк), мы рассматривали морфологические характеристики метацестод, вовсе не изученных методами электронной микроскопии, исключая циклоцерк и стробилоцисту, которым посвящено по одной работе .

Циклоцерк Microsomacanthus microskrjabini Spassky et Jurpalova, 1964 в целом схож по своей морфологии с ранее описанной метацестодой того же типа – Fimbriaria fasciolaris (Pallas, 1781), однако для него характерен мощный псевдомиелиновый слой, заполняющий полость цисты после выхода метацестоды. У F. fasciolaris этот слой не выражен (Краснощеков, Плужников, 1984). Также обнаружены различия в строении стробилоцист двух видов

– ранее изученного Lateriporus geographicus Cooper, 1921 из пресноводных гаммарусов (Krasnoshchekov et al., 1985) и L. aecophylus Oschmarin, 1950 из морских бокоплавов. Отличия состояли в толщине слоёв стенки цисты и разном характере секрета цитонов, что, вероятно, является морфологическим выражением адаптации к обитанию в морской ракообразном .

Тектациста – цистицеркоид Microsomacanthus paraparvula Regel, 1994 из ручейников, сочетающий характеристики циклоцерка и церкоцисты. Он имеет неклеточную наружную оболочку, как циклоцерк, однако его хвостовой придаток выходит из оболочки и развивается снаружи. Мы обнаружили, что морфология стенки эндоцисты полностью соответствует таковой других гименолепидид, а неклеточная наружная оболочка сохраняет свою целостность только при контакте с гликокаликсом тегумента эндоцисты; при отслоении экзоциста приобретает признаки деструкции .

Наружная оболочка (экзоциста) аскоцерков из личинок стрекоз образует замкнутую полость, куда открываются экскреторные поры. Вероятно, эта особенность препятствует массивному поступлению антигенов в брюшную полость хозяина, и, таким образом, обеспечивает сохранность и хозяина и паразита в течение растянутого (до 2–3 лет) жизненного цикла. Тегумент эндоцисты заполнен плотным материалом, как у представителей семейства Hymenolepididae, а у гигантского аскоцерка (мегалоцерка) тегумент формирует поверхностную спиральную структуру, по-видимому, способствующую проникновению через перьевой фильтр в желудке окончательных хозяев – поганок. Интересна морфология почкующегося аскоцерка (мультицерка): установлено значительное сходство этой метацестоды с гидатидной цистой эхинококков, причём отсутствие выводковых камер у мультицерка говорит об упрощенном механизме образования новых особей. Возможно, это обстоятельство связано с большей эволюционной древностью мультицерка по сравнению с гидатидной цистой .

Изучена морфология почкующихся цистицерков Taenia crassiceps (Zeder,

1800) из печени полёвок-экономок Microtus oeconomus (Pallas). Почки образуются на поверхности пузыря, который у этих метацестод играет роль защитной цисты. Установлено, что в молодой почке в первую очередь формируются покровные и мышечные элементы, затем – экскреторные и нервные .

Защитные функции покровов пузыря реализуются в виде секреции материала, заполняющего пространство между микротрихиями; образующийся механический и химический барьер препятствует проникновению клеток хозяина к поверхности метацестоды .

Таким образом, рассмотрена морфология основных типов метацестод циклофиллидей, отмеченных на территории Магаданской области. Сравнение с уже изученными представителями типов выявили отличия, характерные для местных метацестод, а общая картина, полученная в ходе многолетнего изучения ультраструктуры метацестод, свидетельствует о разнообразии морфологических адаптаций, развившихся в условиях Крайнего Северо-Востока России .

–  –  –

Институт биологических проблем криолитозоны СО РАН, 677980, г. Якутск, пр-т Ленина, 41, Россия; nkpotapova@gmail.com Биотопическая приуроченность – важный показатель, указывающий на способность вида существовать в различных условиях среды. Существует несколько статистических методов, оценивающих данную характеристику (Песенко, 1982; Наглов, Загороднюк, 2006). В данной работе применен один из них – показатель степени биотопической приуроченности, формула которого следующая: Fij = (nij N – ni Nj) / (nij N + ni Nj – 2nij Nj) (Песенко, 1982). Величина Fij изменяется от «–1» до «+1», первая величина означает, что вид отсутствует в биотопе, а вторая – вид встречается только здесь. Значение Fij меньше нуля следует считать, что вид избегает биотоп, а если ближе к единице, значит вид приурочен к ценозу (Песенко, 1982) .

Материал и методы. Наблюдения проводились в черте г. Якутска в 2000, 2004, 2007–2017 гг. Учетные площадки представляет гидроморфный ряд от поймы р. Лены – Зеленый луг (ЗЛ); на I надпойменной террасе – озеро Сайсары (Сай) и 11 км Покровского тракта (ПТ); на II надпойменной террасе – Сергелях (Сг), Сосновый бор (СБ), Ботанический сад (БС), Туббольница (ТБ) .

Всего водоемов – 43, типы водоемов: старичные озера – 4, болота – 9, малые постоянные – 5, малые эфемерные водоемы – 25. Использованы общепринятые методы (Мончадский, 1952; Николаева, Ольшванг, 1978), проведено учетов – 304, собрано 16 тысяч личинок и куколок комаров .

Результаты. В ходе многолетних наблюдений выявлен состав кровососущих комаров г. Якутска, насчитывающий 20 видов (Потапова, 2011). Частично затрагивались вопросы биотопической приуроченности на основании фенологических наблюдений и показателях численности, что, однако, не может служить надежным критерием такой оценки (Потапова, 2013, 2014) .

Расчеты показателя степени биотопической приуроченности (Fij) приведены в таблице .

В озерах из встречающихся 10 видов комаров группа летних явно стенотопна (Fij = 0.72–0.93). Виды других фенологических групп либо отсутствуют, либо показатели Fij демонстрируют избегание этого типа водоемов, за исключением личинок Oc. mercurator, которые ежегодно выплаживаются на одном из мелководий оз. Сергелях .

В болотах суммарно встречается самое большое число видов – 15. Высокую степень приуроченности демонстрируют представители всех фенологических групп, на что указывают высокие значения Fij: ранневесенние – Oc .

Таблица. Данные показателя биотопической приуроченности (Fij) личинок кровососущих комаров в учетных водоемах г. Якутска

–  –  –

dorsalis (0.62); поздневесенние – Oc. cyprius (0.59–0.72); летние – An. messeae (0.84), Cu. alaskaensis (0.56–0.71), Cu. bergrothi (0.91) .

Малые постоянные водоемы, в основном антропогенного происхождения, заселены 8 видами, среди которых высокую степень приуроченности к данному типу показывают болотный вид Oc. cyprius – 0.71, также Oc. mercurator

– 0.38 .

В эфемерных водоемах встречаются 10 видов, из них выделяются ранневесенние Oc. cataphylla и Oc. сommunis (Fij = 0.41) .

Обсуждение. Несмотря на примерно одинаковое распределение числа видов по типам водоемов, качественный состав их различен .

Величины Fij показывают, что виды комаров ранневесенней фенологической группы – эвритопны, заселяют все биотопы, включая озера, несмотря на то, что демонстрируют явное избегание этого биотопа. Эти виды обладают достаточно большой экологической пластичностью, способны к активному расселению во все типы водоемов, т.к. выдерживают низкие температуры ранней весной, способны к быстрым циклам развития, адаптированы к неблагоприятным условиям среды обитания .

Из 9 поздневесенних видов шесть стенотопны и встречаются только в одном типе водоема или в болотах (Ae. cinereus, Ae. vexans, Oc. intrudens, Oc .

pullatus) или в малых водоемах (Oc. fitchii, Oc. riparius). Активное расселение характерно для Oc. cyprius, тяготеющего к постоянным водоемам, в частности, к болотам, и эвритопным Oc. euedes, Oc. flavescens, Oc. mercurator, у которых в некоторых водоемах фиксируются отрицательные значения показателя Fij .

Виды летней фенологической группы показывают высокую степень приуроченности к озерам и примыкающим к ним болотам .

Таким образом, в стратегии комаров к расселению можно выделить две группы: эвритопные – это виды ранневесенних и поздневесенних фенологических групп, которые заселяют разные типы водоемов, несмотря на отрицательные значения показателя Fij. Стенотопными являются виды летней фенологической группы, приуроченные к озерам и примыкающим к ним болотам .

Неясным остается положение 6 видов из поздневесенней фенологической группы, которые обнаружены однократно, необходимы дальнейшие наблюдения и учеты для более достоверных выводов .

Литература

Наглов В.А., Загороднюк И.В. Статистический анализ приуроченности видов и структуры сообществ // Теріофауна сходу України. Праці Теріологічної школи, вип. 7,

2006. С. 291–300 Песенко Ю.А. Принципы и методы количественного анализа в фаунистических исследованиях / М.: Наука, 1982. 288 с .

Потапова Н.К. Особенности экологии личинок кровососущих комаров (Diptera, Culicidae) в урбаценозах Центральной Якутии // Тр. РЭО. С.–Петербург, 2011. Т .

82. С. 97–105 .

Потапова Н.К. Биотопическое распределение личинок комаров (Diptera, Culicidae) в водоемах г. Якутска // Паразитология в изменяющемся мире. Материалы V съезда паразитологического общества при Российской академии наук: Всероссийской конференции с международным участием (23–26 сентября 2013., Институт систематики и экологии животных СО РАН, Новосибирск). Ред. К.В.Галактионов // Новосибирск: Гарамонд, 2013. С. 149 .

Потапова Н.К. Особенности развития личинок кровососущих комаров (Diptera, Culicidae) разных фенологических групп в урбоценозах г. Якутска // Труды Центра паразитологии ИПЭЭ им. А.Н.Северцова РАН. Т. XLVIII: Систематика и экология паразитов. Отв. ред. С.О.Мовсесян. Москва, 2014. С. 250–252 .

ОСОБЕННОСТИ РАСПРЕДЕЛЕНИЯ МОНОГЕНЕЙ

РОДА LIGOPHORUS НА ЖАБРАХ ЧЕРНОМОРСКИХ

КЕФАЛЕЙ В ЗАВИСИМОСТИ ОТ ЧИСЛЕННОСТИ

Пронькина Н.В., Дмитриева Е.В .

Институт морских биологических исследований им. А.О. Ковалевского РАН, 299011, Севастополь, natalya-pronkina@yandex.ru На сингиле Chelon aurata, остроносе C. saliens, лобане Mugil cephalus и пиленгасе Planiliza haematocheilus в Черном море массово встречаются семь видов моногеней рода Ligophorus Euzet et Suriano, 1977: L. vanbenedenii (Par .

et Per., 1890), L. szidati Euzet et Suriano, 1977, L. acuminatus Euzet et Suriano, 1977, L. mediterraneus Sarabeev, Balbuena et Euzet, 2005, L. cephali Rubtsova, Balbuena, Sarabeev, Blasco-Costa et Euzet, 2006, L. pilengas Sarabeev et Balbuena, 2004 и L. llewellyni Dmitrieva, Gerasev et Pronkina, 2007. Для изучения их распределения жабры кефалей делились на: 4 жаберные дуги (I – IV), 3 сектора (1 – спинной, 2 – срединный, 3 – брюшной), переднюю и заднюю полужабры (для лобана и пленгаса), проксимальную и дистальную половину жаберных лепестков (только у пиленгаса). Рассчитывалась доля (%) моногеней каждого вида, локализующихся на выделенном участке жабр каждой рыбы .

Все изученные виды лигофорусов распределяются по жаберному аппарату кефалей неравномерно и большинство совместно встречающихся видов локализуются на жаберных дугах и секторах по–разному .

Так, на сингиле особи L. vanbenedenii встречаются на I–III жаберных дугах примерно в равных долях, предпочитая 2-й сектор этих дуг. В то время как паразитирующий на этом же хозяине L. szidati предпочитает IV дугу, на которой встречено около половины особей этого вида, локализующихся в основном на 2 и 3 секторах .

Из двух видов моногеней, найденных на остроносе, L. acuminatus предпочитает I–II жаберные дуги, на которых локализуется около 60% этих моногеней, и половина особей зарегистрирована на 2 секторе. Второй вид – L. szidati встречается на II–IV дугах и больше 60% его особей локализовалось на 2 секторе .

На лобане виды L. mediterraneus и L. cephali предпочитают паразитировать на I–III жаберных дугах, но при этом наибольшая доля особей первого вида (30%) встречается на I дуге, а 40% L. cephali – на II дуге. На каждой жаберной пластинке наибольшая доля моногеней встречена на 2 секторе и более 60% особей обоих видов найдены на передней полужабре .

В отличие от предыдущих видов, L. pilengas и L. llewellyni, совместно паразитирующие на пиленгасе, предпочитают одни и те же участки жабр: I – III жаберные пластинки как с левой, так и с правой сторон жаберного аппарата, 2 и 3 сектора, переднюю полужабру и проксимальную часть жаберного лепестка .

Кроме L. szidati, около половины особей которого встречается на IV жаберной дуге, остальные виды избегают эту жабру и все виды практически не встречались на 1 секторе, избегали заднюю полужабру (для лобана и пиленгаса) и предпочитали дистальную часть жаберного лепестка (для пиленгаса) .

Одним из факторов, который может влиять на характер распределения моногеней по жабрам, является численность их инфрапопуляций. Для анализа влияния этого фактора исследованные рыбы были разделены на группы по интенсивности их инвазии (ИИ) каждым видом Ligophorus: для видов с Chelon aurata выделено по 5 групп, для Chelon saliens – по 2, для Planiliza haematocheilus – по 4 и для Mugil cephalus – по 3, в зависимости от размаха вариабельности ИИ и количества исследованных рыб каждого вида .

В целом, при изменении численности каждого исследованного вида отмечалась тенденция к выравниванию между долями особей, локализующихся на разных участках жаберного аппарата рыб .

Так, при возрастании ИИ L. vanbenedeni наблюдается изменение соотношения между долями моногеней этого вида, локализующихся на 2 и 3 секторах. При численности 10 экз./особь около 60% особей встречались на 2 секторе и около 30% на 3 секторе, а при ИИ 30 экз./особь доли моногеней на этих секторах были практически одинаковы. Аналогично, при ИИ L. szidati 51 экз./особь доля червей, которые встречаются на IV дуге, снижается c 60 до 40% и, соответственно, увеличиваются их пропорции на других дугах .

Распределение L. acuminatus по жабрам остроноса согласуются с результатами, полученными для L. vanbenedeni и L. szidati от сингиля. Так, при росте ИИ моногенеи этого вида распределяются более равномерно, в 2 раза возрастает их доля на IV дуге и выравнивается встречаемость на II и III дугах .

Отмеченная тенденция к выравниванию встречаемости моногеней на разных участках жабр с увеличением ИИ наблюдается так же и для других исследованных видов. Так, при росте численности L. mediterraneus уменьшалась разница между долями особей, локализующихся на I и II–III жаберной дугах; при увеличении ИИ L. cephali – между долями на I–II и III дугах; и для обоих видов с пиленгаса – между I и II жаберными дугами .

Однако выявленное влияние численности на равномерность распределения лигофорусов по жабрам рыб не приводило к появлению моногеней на тех участках жаберного аппарата, которых они избегают. Так, например, все виды, за исключением L. szidati, практически не встречаются на IV жаберной дуге, и эта закономерность сохраняется при всех значениях ИИ .

В целом, с ростом численности инфрапопуляций для всех видов наблюдалось увеличение индексов ширины ниши (Koskivaara et al., 1992), при этом индекс внутривидовой агрегации (J) (Morand et al., 1999) при всех значениях численности был 0, что говорит о том, что особи одного вида положительно ассоциированы, даже при низкой ИИ .

Пространственные ниши совместно встречающихся на одном хозяине видов перекрывались, в среднем, на 40–50%, увеличение численности инфрапопуляций приводило к увеличению этого показателя до 60%. С другой стороны, с ростом ИИ наблюдалось снижение индекса межвидовой агрегации (Morand et al., 1999). Высокие значения индекса А (ibid.), которые хотя и уменьшались при увеличении ИИ, однако были значительно больше 1, характеризуют достоверно более высокую внутривидовую агрегацию особей по сравнению с межвидовой .

Таким образом, общий характер распределения изученных видов Ligophorus на жабрах кефалей не зависел от численности их инфрапопуляций, но при увеличении интенсивности инвазии отмечена тенденция к выравниванию их встречаемости на разных участках жабр; ширина ниши увеличивалась, но каждый вид занимал не более 40% потенциального биотопа;

сохранялась положительная внутривидовая агрегация, существенно превышающая степень межвидовых ассоциаций .

Литература

Koskivaara M., Valtonen E.T., Vuori K.M. Microhabitat distribution and coexistence of Dactylogyrus (Monogenea) on the gills of roach // Parasitology. 1992. Vol.104. P. 273– 281 .

Morand S., Poulin R., Rohde K., Hayward C. Aggregation and species coexistence of ectoparasites of marine fishes // International Journal for Parasitology. 1999. Vol. 29. P .

663–672 .

ВИДОВАЯ ИДЕНТИФИКАЦИЯ ТРЕМАТОД РОДА

LEUCOCHLORIDIUM

Прохорова Е.Е, Виноградова А.А., Лопатина О.Д., Коломиец А.А .

–  –  –

На территории европейской части Евразии встречаются представители трёх родов семейства Leucochlorididae: Leucochloridium, Urogonimus и Urotocus. Основными морфологическими признаками, позволяющими различать представителей этих родов, являются форма и размер присосок, ветвей кишечника, степень развития желточников, взаимное расположение гонад, форма матки, размер цирруса и др. Для видов этого семейства характерна большая степень изменчивости морфологических признаков, что возможно объясняется паразитированием у широкого круга хозяев – как птиц, так и млекопитающих. Это обстоятельство усложняет идентификацию видов семейства Leucochlorididae (Kagan, 1952) .

Уникальность трематод данного семейства заключается в возможности определения некоторых его представителей по строению спороцист (прежде всего по форме и окраске отростков столона) (Быховская-Павловская, 1951) .

Объектом нашего исследования Leucochloridium paradoxum, описываемого также под названиями L. heckerti (Kagan, 1950, цит. по Быховская-Павловская, 1951) и Distoma macrostomum (Heckert, 1889, цит. по Halik, 1931). Партениты этих видов описаны на Европейской территории России только в моллюсках Succinea putris. Валидность используемых для видовой идентификации Leucochloridium paradoxum морфологических признаков была подтверждена с использованием в качестве генетического маркера протяжённой последовательности фрагмента рДНК (4444 п.н.) (Ataev et al., 2016). При этом L .

paradoxum достоверно отличался по нуклеотидным последовательностям внутренних транскрибируемых спейсеров от представителей двух других видов – L. perturbatum и L. vogtianum .

Выявленный протяжённый участок рДНК L. paradoxum может быть использован для определения соответствия друг другу различных фаз жизненного цикла паразита. С целью получения марит было осуществлено экспериментальное заражение цыплят метацеркариями этого вида. Через 8, 14 и 21 день после заражения из цыплят были получены мариты, по морфологическим признакам являющиеся L. paradoxum. Этот вывод был также подтвержден генотипированием марит по участку рДНК. Полученные результаты подтвердили, что изучаемые спороцисты с отростками зеленого цвета действительно относятся к виду L. paradoxum. Соответственно получено окончательное доказательство возможности идентификации этого вида по особенностям строения спороцист .

На следующем этапе исследования также было осуществлено генотипирование партенит из разных географических точек (Санкт-Петербург, Гатчинский и Бокситогорский районы Ленинградской области). Во всех случаях образцы спороцист с зелёными отростками оказались идентичны между собой по участкам рДНК. Генетическая однородность L. paradoxum подтверждается и результатами RAPD-анализа (Prokhorova et al., 2017). Удалось получить специфические праймеры, позволяющие идентифицировать L. paradoxum без осуществления секвенирования (Prokhorova et al., 2017) .

Литература

Ataev G.L., Zhukova A.A., Tokmakova A.S., Prokhorova E.E. Multiple infection of amber snails Succinea putris with sporocysts of Leucochloridium spp. (Trematoda) // Parasitology Research. 2016. Vol. 115 (8). P. 3203–3208 .

Halik L. ber die rhythmischen bewegungen der in Bernsteinschnecken parasitierenden sporozystenschlauche von Leucochloridium macrostomum Rud. (= L. paradoxum Carus) // Zeitschrift fr vergleichende Physiology. 1931. Vol. 14. P. 462–478 .

Kagan I. Revision of the subfamily Leucochloridiinae Poche, 1907 (Trematoda, Brachylaemidae) // Amer. Madland. Naturalist. 1952. Vol. 48. P. 257–301 .

Prokhorova E.E., Zhukova A.A., Tsymbalenko N.V., Lopatina O.D., Ataev G.L. RAPD markers for species identification of trematodes from the genus Leucochloridium // Паразитология. 2017. Т. 51. № 4. С. 339–344 .

Быховская-Павловская И.Е. Изменчивость морфологических признаков и ее значение в систематике рода Leucochloridium Carus, 1835 // Паразитологический сборник. 1951. Т. 13. С.45–74 .

<

–  –  –

Институт биологических проблем Севера ДВО РАН, 685000, г. Магадан, ул. Портовая, 18, Россия; kire@ibpn.ru, 8(4130) 634542 Скрябин (Skrjabin, 1914, p. 467, fig. 61) даёт краткое описание Hymenolepis solowiowi по мацерированному материалу от белоглазого нырка Aythya nyroca L. из Русского Туркестана – Аулие-Атинского уезда Сыр-Дарьинской области (ныне г. Тараз, Южный Казахстан). Позднее, Тзенг-Шен (Tseng-Shen, 1932) регистрирует H. solowiowi (также без сколексов) у шилохвости Anas acuta L. в Китае, а также описывает (по фрагментам стробилы и сколексам) новый вид Fuhrmanniella fausti Tseng-Shen, 1932. Ряд авторов (Lopez-Neyra, 1941; Спасский, 1956; Спасская, 1966), не признавая видовую самостоятельность H .

solowiowi, рассматривали этот вид как синоним Microsomacanthus compressa (Linton, 1892). Беверли-Бартон (Beverley-Burton, 1964), отстаивая самостоятельность H. solowiowi, приводит описание комплектных особей от шилохвости и хохлатой чернети Aythya fuligula (L.) из Англии. Сравнивая его с тремя близкими видами (с такой же мощной мышечной оболочкой бурсы цирруса), Беверли-Бартон отмечает, что по длине и форме хоботковых крючьев H .

solowiowi идентичен виду Hymenolepis fausti (Tseng-Shen, 1932) Fuhrmann, 1932, но по топографии (и размеру) семенников, несомненно, отличается .

Позже Чаплинский и Воше (Czaplinski, Vaucher, 1977) провели ревизию типовой серии препаратов F. fausti Tseng-Shen, 1932 и констатировали присутствие на трех препаратах двух видов, чьи параметры использованы при описании F .

fausti: M. spiralibursata (Czaplinski, 1956) и M. paramicrosoma (Gasowska, 1932) .

Таким образом, вид F. fausti был аннулирован как сборный, а цестоды, описанные Спасской и Спасским (1961) как Microsomacanthus fausti, признаны новым видом и для него предложено название M. baeri Czaplinski, Vaucher,

1977. Максимова (1989) приводит подробную историю таксона и морфологическую характеристику M. baeri по материалу от хохлатой чернети из Казахстана .

В нашей коллекции цестод Охотско-Колымского края этот вид также встречен у хохлатой чернети. Характерная форма и размер бурсы цирруса, параметры полностью эвагинированного (в большинстве проглоттид и стробил) цирруса, а также форма вагины, идентичны описанию и рисунку H. solowiowi по Skrjabin, 1914 (рис.1, рис. 2 а,б). Поддерживая мнение Беверли-Бартон (Beverley-Burton, 1964) о самостоятельности этого вида, предлагаем включить его в состав подрода Leuckartсohnacanthus Galkin, Regel, 2010 рода Microsomacanthus как M. (L.) solowiowi (Skrjabin, 1914) comb. nov .

В синонимы вида помещаем M. fausti sensu Spasskaja et Spassky, 1961 и, соответственно, M. baeri Czaplinski, Vaucher, 1977. В таблице приводим основные параметры перечисленных видов по литературным и собственным данным. Большая длина цестод в материале Скрябина может быть связана с сильной релаксацией (мацерацией) стробил. Кроме того, этот вид, также как другие представители подрода: M. (L.) compressa; M. (L.) paracompressa Czaplinski, 1956; M. (L.) paramicrosoma, M. (L.) spiralibursata; M. (L.) spasskii Tolkacheva, 1971, может иметь две формы, мелкую и крупную. Все размеры в таблице и далее приведены в мм .

Итак, среди перечисленных видов данной группы микросомакантусов два вида имеют идентичные по длине и форме крючья хоботка: это обсуждаемый вид M. (L.) solowiowi и M. (L.) spiralibursata. Последний вид хорошо отличается деталями строения половозрелых проглоттид. Отметим, что все шесть перечисленных выше видов встречены у одного самца хохлатой чернети в период весенней миграции (добыт на берегу Ольской лагуны). Кроме них, у этой птицы обнаружен неизвестный вид Microsomacanthus (L.) sp. (Рис. 2 в, г). Параметры его хоботковых крючьев идентичны M. (L.) solowiowi. Семенники также расположены в один ряд по типу VI, бурса цирруса имеет вполне развитый мускульный слой, но он слабее, чем у M. (L.) solowiowi. Заметно отличаются у этой пары видов циррусы и, соответственно, копулятивные части вагины. Циррус неизвестного вида длиннее, в основании он шире – до 0.022, против 0.012–0.015 у M. (L.) solowiowi. Базальная конусовидная часть цирруса M. (L.) sp. на расстоянии 20 мкм от основания переходит в длинную Таблица. Метрические характеристики M. (L.) solowiowi (Skrjabin, 1914)

–  –  –

* вычислены согласно рисунку автора (Skrjabin, 1914, figure 61) и данным о размере мускульной части бурсы .

трубковидную часть диаметром около 0.007. Таким образом, видовое разнообразие микросомакантусов подрода Leuckartсohnacanthus в регионе представлено минимум семью видами .

–  –  –

Максимова А.П. Цестоды – гименолепидиды водных птиц Казахстана / Алма–Ата, Наука. 1989. 223 С .

Спасская Л.П., Спасский А.А. Цестоды птиц Тувы. II. Род Microsomacanthus (Hymenolepididae) // Acta veterinaria Ac. Si. Hungar. 1961. V. 11. P. 13–53 .

Beverley-Burton M. Studies on the Cestoda of British fresh water birds // Proc. Zool. Soc .

London. 1964. V. 142. P. 307–346 .

Czaplinski B., Vaucher C. Revision de Fuhrmaniella fausti Tseng Shen, 1932. Ann. Parasitol .

1977. V. 52. N. 3. P. 253–258 .

Skrjabin K.I. Vogelcestoden aus Russisch Turkestan // Zoologischen Jahrbchern. Abteilung fr Systematik, Geographie und Biologie der Tiere. 1914. V. 37. P. 411–492 .

–  –  –

Зоологический институт РАН, 199034, Санкт-Петербург, nema@zin.ru Стволовые нематоды это ксилобионты из сем. Aphelenchoididae, включающего виды рода Bursaphelenchus и близких клад. В цикле нематод обязательно имеется сапроксильный гриб и разрушаемое грибом древесное растение. Для многих видов известен переносчик, форезирующий дауеров, т.е. особых не питающихся личинок специализируемого трансмиссивного поколения. Дауеры морфологически отличаются от личинок пропагативного поколения паразитирующего в грибах во внутреннем цилиндре под корой ствола, заболони: в флоэме, и смоляных ходах хвойных. Цель исследования: выяснить последовательность приобретения трех ассоциантов поликсенного цикла .

Первичным хозяином паразитической нематоды служил гриб, на что указывают важнейшие адаптации строения микотрофной глотки и слабой колющей стомы, а также наличие в корневых кладах кладограммы сем. Aphelenchoididae видов с циклом с одним хозяином, грибом. Поэтому задача сводится к выявлению последовательности в дальнейшем приобретении насекомого и растения хозяина .

Дауеры, как стадии покоя, морфологически не идентичны личинкам пропагативного поколения из-за редукции глотки и стомы. В лабораторной популяции пропагативного поколения имеется небольшая часть стрессо-устойчивых резистентных личинок 3 и 4 стадий, однако дауеры отличаются морфологически от этих резистентных личинок в том, что у них значительно редуцирована стома и глотка, а также удлиненной формой тела. Дауеры не обязательно связаны с переносчиками, их появление совпадает с сезонными явлениями (наступлением зимы) и дефицитом пищи, они сохраняются в древесине несколько лет в отсутствие переносчиков. По концепции функциональных гильдий в сукцессии детритной пищевой цепи (Ferris et al, 2003), виды нематод с дауерами относятся к наиболее активным колонизаторам с значением 1 по пятибальной c–p шкале и служат индикаторами первичного заселения мертвого органического субстрата в траектории “Enrichment” (обогащения). Т.е .

исходно ассоциация нематоды и растения-хозяина – это связь детритофага и свежего трупа, богатого свободной органикой. Но ассоциация нематоды и переносчика – это функциональная система живых организмов. Эта система специфична на уровне родов нематоды и насекомого, по опубликованным данным находок. Однако дауер сформировался не из-за включения в цикл нематод переносчика. Дауеры как фаза альтернативной трансмиссивного поколения цикла существовали до включения в цикл переносчика. Но при появлении переносчика они приобрели новую функцию, стали форезируемой стадией и сформировали ряд видо-специфичных адаптаций к конкретному переносчику. При этом третий ассоциант нематод – растение хозяин фигурировал в цикле лишь как пищевой объект гриба, в свою очередь служащего пищей нематодам. Растение использовалось как мертвый субстрат, а не как живой организм. В наших экспериментах прямой инокуляции нематод Bursaphelenchus spp. в растения, минуя насекомое, показано, что нематоды обладают собственной специфичностью к живому растению, а не только следуют приоритетам своих переносчиков в отношении субстратов яйцекладки и питания (Рысс и др., 2018). Это свидетельствует, что после приобретения циклом нематод переносчика произошла вторичная специализация к умирающему, но еще живому растению. В последующей эволюции древесное растение становится настоящим хозяином нематод, а не просто субстратом для гриба, на котором нематода питается. Но специфичная адаптация к растению произошла исторически уже после адаптации нематоды к переносчику .

На примере филогении рода Bursaphelenchus с помощью статистического пакета SIMMAP показана эволюция ассоциаций нематод с насекомыми и растениями. Выделены три направления (макроклады) этой эволюции жизненных циклов (Рысс, Субботин, 2017). В этих линиях наблюдается множество реверсий: каждый шаг вперед в адаптациях сопровождался несколькими шагами назад к привычным (типичным для предков) нишам и ассоциациям с растениями и переносчиками .

Изложенная концепция объясняет, почему для стволовых нематод не подтверждается гипотеза сопряженной эволюции. В соответствии с последней, ассоциативные связи с наиболее древним хозяином в цикле соответствуют наиболее узкой специфичности паразита. А в случае стволовых нематод связь с растением менее специфична, чем связь с насекомым. Исторически насекомое переносчик – недавний партнер паразита в жизненном цикле, по сравнению с более древним растением-хозяином .

Поддержка: проект РАН «Разнообразие паразитарных систем, адаптаций и путей эволюции паразитов». Гос. регистрационный номер: АААА-А17Госзадание АААА-А17-117080110040-3 ФАНО РФ “Инвентаризация и развитие фондовых коллекций ЗИН РАН” .

Литература

Рысс А.Ю., Субботин С.А. Коэволюция стволовых нематод рода Bursaphelenchus Fuchs, 1937 с насекомыми переносчиками и растениями–хозяевами // Журнал Общей биологии. 2017. Т. 78. С. 32–61 .

Ferris H., Bongers T., de Goede R.G.M. A framework for soil food web diagnostics: extension of the nematode faunal analysis concept // Applied Soil Ecology. 2001. Vol. 18. P.13– 29 .

Ryss A.Y., Polyanina K.S., Popovichev B.G., Krivets S.A., Kerchev I.A. Plant host range specificity of Bursaphelenchus mucronatus Mamiya et Enda, 1979 tested in the laboratory experiments // Паразитология. 2018. Т. 52. С. 32–40 .

СТВОЛОВЫЕ НЕМАТОДЫ ЛИСТВЕННЫХ

ДЕРЕВЬЕВ: ЦИКЛ РАЗВИТИЯ И СПЕЦИФИЧНОСТЬ

К РАСТЕНИЯМ-ХОЗЯЕВАМ

Рысс1 А.Ю., Полянина1 К.С., Скрябина2 М.Д .

Зоологический институт РАН, Университетская наб., 1, Санкт-Петербург, 199034,

–  –  –

Нематодные болезни увядания лиственных деревьев (на примере вилта вяза и ясеня) носят мульти-патогенный характер с участием фитопатогенных грибов сем. Ophiostomatacae и насекомых-переносчиков сем. Curculionidae .

Было выявлено 24 вида нематод, два вида относятся к патогенному р .

Bursaphelenchus. Для изучения цикла развития и проведения фитотестов на специфичность к растениям-хозяевам нематод размножали в лабораторной культуре гриба Botrytis cinerea. Выявлено 5 стадий цикла, разделенные четырьмя линьками (пятая стадия – половозрелые самец и самка). Первая линька проходит внутри яйцевой оболочки, из яйца выходит личинка второй стадии (J2). Установлены диагностические признаки стадий и пола по размерам, структуре полового зачатка и зачатков половых органов. Дауер-личинки трансмиссивного поколения, форезируемые короедами, по строению полового зачатка относятся к J3 стадии; однако у дауеров редуцирована стома и глотка, хорошо развитые у личинок пропагативного поколения. Идентифицировать половую принадлежность по половому зачатку и зачаткам копулятивных органов возможно с третьей стадии (J3). Проведены фитотесты черенках нескольких видов хвойных и лиственных деревьев. Тесты проведены без переносчика прямой инокуляцией паразитов в растение. Они доказывают наличие самостоятельной специфичности фитонематод к видам растений-хозяев, которая не обусловлена предпочтениями переносчика к питанию и яйцекладке на конкретных видах растений .

Поддержка: проект РАН АААА-А17-117030310322-3 «Разнообразие паразитарных систем, адаптаций и путей эволюции паразитов», госзадание ФАНО РФ АААА-А17-117080110040-3 “Инвентаризация и развитие фондовых коллекций ЗИН РАН”; грант РФФИ 17-04-00360a «Фауна короедов (Coleoptera: Curculionidae: Scolytinae) России и сопредельных стран: новый взгляд с позиции современной систематики, молекулярной филогенетики, биогеографии» .

–  –  –

ФГБНУ «Камчатский научно-исследовательский институт рыбного хозяйства и океанографии», 683000, г. Петропавловск-Камчатский, ул. Набережная 18, Россия, ryazanova.t.v@kamniro.ru Материал и методы. Сбор материала проводили в 2012, 2014, 2016, 2017 гг. в ходе летних комплексных траловых съемок в шельфовой зоне Западной Камчатки. Работы велись в диапазонах широт от 51°10' с.ш. до 57°40' с.ш., на глубинах от 15 до 200 м. В качестве орудия лова применялся донный трал «ДТ 27.1/33.7 м» .

На каждой траловой станции при определении видового и количественного состава улова отбирали ракообразных с визуальными признаками болезней. По данным учетов по улову рассчитывали долю больных особей на каждой станции. Всех ракообразных с признаками заболеваний исследовали патологоанатомически и отбирали пробы для гистологического анализа. В 2017 г. дополнительно исследовали рандомизированную пробу (42 экз.) визуально здоровых северных креветок. Отобранные образцы внутренних органов ракообразных фиксировали в жидкости Дэвидсона на морской воде. Дальнейшую обработку проб проводили по общепринятым методикам (Bancroft et al., 1990). Полученные препараты изучали под световым микроскопом Olympus ВН–2, имеющим автоматическое фотографическое устройство. При измерении паразитов или их отдельных частей использовали окуляр-микрометр .

Результаты и обсуждение. Ежегодно в уловах северной креветки отмечали экземпляры более яркого, чем в норме, оранжевого цвета с просвечивающей сквозь покровы тела желтой гемолимфой. Такие особи были зарегистрированы на станциях, расположенных в северной части шельфа. Превалентность по станциям составляла от 0 до 7.3%. Средняя превалентность заболевания в уловах северной креветки по годам варьировала незначительно и не превышала 1%. У других видов креветок, которые также встречались в уловах (углохвостая P. goniurus, гребенчатая P. hypsinotus, равнолапая Pandalopsis lamelligera и др.), подобных клинических признаков ни разу не отмечали .

Заболевание с похожими визуальными признаками у ракообразных вызывают паразитические динофлагелляты рода Hematodinium. В камчатских водах в настоящее время эта инвазия зарегистрирована у пяти видов промысловых крабов. Однако при микроскопических исследованиях образцов внутренних органов больных северных креветок обнаружили паразита иного морфологического строения. В большинстве своем это были одноядерные округлые клетки размером 12.5 ± 0.5 мкм с центральным круглым базофильным ядром .

В эозинофильной цитоплазме клеток паразита были хорошо видны концентрически расположенные неокрашенные вакуоли и мелкие базофильные включения. Изредка отмечали более крупные плазмодиальные клетки, содержащие по два или три ядра. Стадии паразита во множестве регистрировали в гемальных синусах и межуточной соединительной ткани всех внутренних органов ракообразных. Отмечали резкое уменьшение количества гемоцитов хозяина, вакуолизацию клеток эпителия гепатопанкреаса, расширение гемальных синусов, деполимеризацию волокон мышечной ткани. Среди 42 экз. визуально здоровых северных креветок инвазию зарегистрировали у одной особи. При гистологических исследованиях обнаружили несколько плазмодиальных клеток, содержащих два либо три ядра, в интерстициальной соединительной ткани гепатопанкреаса. Каких либо патологических изменений тканей внутренних органов не отмечали .

Обсуждение. По полученным данным обнаруженный у северной креветки простейший паразит является тем же или близок к SPP (spot prawn parasite), известному у двух видов креветок рода Pandalus, обитающих у берегов Аляски и Британской Колумбии (Meyers et al., 1994; Bower, Meyer, 2002). По данным генетических исследований этот организм является представителем типа Haplosporidia (Reece at al., 2000). Более точное таксономическое положение остается неясным, поскольку его морфологические признаки не соответствуют ни одному из описанных родов гаплоспоридий. Исследования инфекции SPP у P. platyceros показали, что паразит имеет довольно сложный цикл развития с образованием нескольких многоядерных и одноядерных форм. Визуальные признаки (изменение цвета наружных покровов и гемолимфы) появляются на поздней стадии заболевания, когда многоядерные плазмодиальные формы сменяются одноядерными трофонтами. То есть длительное время инвазия существует в скрытой форме. Так, по данным учета P. platyceros в Британской Колумбии превалентность заболевания по визуальным признакам составляла около 2%. В тоже время результаты гистологических исследований показали скрытую форму инвазии (т.е. на ранней стадии) у 20% особей из выборки визуально здоровых креветок. Таким образом, учет больных ракообразных в общих уловах по визуальным признакам дает большую ошибку (Bower, Meyer, 2002) .

По данным учета северных креветок с внешними признаками заболевания, его превалентность в северной части шельфа Западной Камчатки небольшая. Однако, как по наличию визуальных признаков, так и по соотношению количества одноядерных и многоядерных форм паразита в образцах тканей, можно сделать вывод, что у исследованных нами особей P. eous была поздняя стадия заболевания. Вполне возможно, что в реальности его превалентность может существенно превышать 1%. Косвенно это предположение подтверждает находка особи с ранней стадией инвазии среди исследованной выборки визуально здоровых ракообразных. Во всяком случае, этот вопрос требует дальнейших исследований .

Литература

Bancroft D., Stevens A. Turner D. R. Theory and practice of histological techniques / Edinburgh–London–Melbourne–New York: Churchill Livingstone Inc. 1990. 725 pp .

Bower S.M., Meyer G.R. Morphology and ultrastructure of a protistan pathogen in the haemolymph of shrimp (Pandalus spp.) in the northern Pacific Ocean // Can. J. Zool .

2002.Vol. 80. P. 1055–1068 .

Meyers T.R., Lightner D.V., Redman R.M. A dinoflagellate-like parasite in alaskan spot shrimp Pandalus platyceros and pink shrimp P. borealis // Diseases of Aquatic Organisms .

1994. Vol. 18. № 1. P. 71-76 .

Reece K.S., Burreson E.M., Hudson K.L., Bower S.M., Dungan C.F. Molecular analysis of a parasite in prawns (Pandalus platyceros) from British Columbia, Canada // J. Shellfish Res. 2000. Vol. 19. P. 647 .

–  –  –

Галловые нематоды являются одним из опасных вредителей сельскохозяйственных культур. Они заражают около 2000 видов культурных и диких растений, принадлежащих к различным семействам, и с каждым годом число их увеличивается. В результате ежегодно мировое сельское хозяйство теряет от 10 до 20% урожая (Васюкова, 2009) .

Цель исследования: изучить влияние арахисовой галловой нематоды Meloidogyne arenaria на морфологию корней растений, определить гистологические изменения корня баклажана в экспериментальных исследоваиях .

Объект исследования – баклажан (Solanum melongena L.). Растение было искуственно заражено арахисовой галловой нематодой – Meloidogyne arenaria .

Анатомическое строение осевых органов корней растений изучали на материале, фиксированном в 70% этаноле по общепринятой методике (Барыкина и др., 1963) .

В качестве объектов исследования были взятые здоровые растения баклажана сорта «Алмаз», которые заражали арахисовой галловой нематодой для определения патогенности фитонематод. Патологические признаки главных и боковых корней баклажана при инвазии арахисовой галловой нематодой проявлялись галлообразованием. Исследования продолжались изучением микроскопии опытных и контрольных вариантов корней растений. Изучая механизмы патогенного воздействия галловых нематод на тканевую структуру баклажана, установили, что у незараженных растений никаких изменений не происходит. Однако изучение зараженных нематодой растений показало патологию клеток и тканей. При развитии личинок галловых нематод и образовании гигантских клеток на корнях баклажана нарушается функция проводящих тканей корня. В период проникновении и миграции галловых нематод в тканях корней растений происходят неспецифические изменения: разрушение эпидермы, разрыхление паренхимы, возникновение мацерации, образование полостей, гипертрофическое разрастание, а затем разрушение паренхимы – это основные патологические изменения, возникающие в зонах очага повреждения (Palomares-Rius et al., 2017). Анализ наших результатов сравнения незараженными и зараженными галловыми нематодами корней баклажана показал, что корневая система зараженного растения сильно изменяется и наблюдаются характерные деструкции, которые возникают в различных участках ткани корней растений. Поперечный срез боковых корней сверху покрыт 3–4 рядной пробкой, ниже которой паренхима коры составляет 50% от центрального цилиндра. В центральном цилиндре функционирует камбий, который содержит 5–6 гранул и образует вторичную ксилему и расположенную между сосудами тонкостенную паренхиму. Радиальные лучи 1–3 рядные. Флоэма составляет около 10% от центрального цилиндра. Были обнаружены нематоды в паренхиме коры. Они обычно расположены в центре галлы, с передней стороны на ксилеме и имеют вокруг рта 6–7 гигантских клеток – циноциты, которые находятся в ксилеме. На одну нематоду в среднем приходится по 4–7 ценоцитов. Циноциты формируются рядом с головой нематодой. Вокруг самки наблюдались цeноциты окруженные гидроцитными клетками. В корневой паренхиме расположена самка и оотека самки с яйцом и личинками. В паренхимной коре можно увидеть оотеку самки заполненную яйцами нематоды (рис.1 А, Б). Патологические признаки ткани и клетки первоначально возникли в корневых каналах и в паренхиме вокруг нематоды .

Стены флоэмы и ксилемы были значительно утолщены и деформированы, а головная сторона седентарной личинки была почти в начале галлы. Было обнаружено, что под давлением нематоды, которая растет в паренхиматозных клетках, клеточная стенка корня становится тоньше и деформируется, а сама ячейка является уплощенным прямоугольником. На поперечных срезах корня пораженного баклажана присутствуют 4–7 гигантских клеток в области головки нематод (рис. 1 Б, С) .

В продольных срезах поврежденных корней четко видны зоны проникновения нематодой корневой ткани, местоположение и зоны воздействия. При исследовании продольных краев поврежденного корня в паренхиме коры былы обнаружены несколько самок нематод (рис. 2) .

Каждая личинка нематод в корне имеет специальную пищевую зону. Как выше указано, вокруг личинок встречаются патологические признаки в корневой паренхиме и в сосудах. Личинки нематоды обычно расположены в области паренхиматозных клеток, близких к центральной цилиндрической области корня. Во время роста и развития личинок при формировании гигантских клеток затягиваются корнепроводящие сосуды, деформируются и увеличеваются расстояния между сосудами (рис. 2 В) .

A C B Рис. 1. Поперечный срез баклажана. Обозначения : ПР–перидерма, РЛ–радиальные лучи, КС– ксилема, ПК– паренхима коры, ФГ–феллоген, О–оотека, Н–нематода, ГЦ–гидроциты, Ц– цeноциты .

Рис. 2. Продольный срез зараженного корня баклажана. Обозначения: ПР–перидерма, КС–ксилема, ПК–паренхима коры, О–оотека, Н–нематода, Л–личинка, Я–яйца .

Таким образом, в результате исследования гистологические изменения ткани корней баклажана при инвазии арахисовой галловой нематодой – Meloidogyne arenaria установлены патологические симптомы: галлы в корнях баклажана, гигантские клетки в корневой паренхиме и затягивание корнепроводящих сосудов .

Литература

Барыкина Р.П., Костринова Л.Н., Кочемарова И.П., Лотова Л.И., Транковский Д.А., Чистякова О.Н. Практикум по анатомии растений / М.: Росвузиздат, 1963.184с .

Васюкова Н.И., Зиновьева С.В., Удалова Ж.В., Герасимова Н.Г., Озерецковская О.Л., Сонин М.Д. Жасмоновая кислота и устойчивость томатов к галловой нематоде // Доклады академии наук, 2009. Том 428, № 3. С. 420–422 .

Juan E. Palomares-Rius, Carolina Escobar, Javier Cabrera, Alessio Vovlas and Pablo Castillo. Anatomical Alterations in Plant Tissues Induced by Plant–Parasitic Nematodes // Frontiers in Plant Science, 2017. Vol. 8. P. 1–16 .

ПАРАЗИТЫ ДИКИХ ЖВАЧНЫХ И ВОЗМОЖНОСТИ

ПРОФИЛАКТИКИ ГЕЛЬМИНТОЗОВ НА ПРИМЕРЕ

БИОСТАНЦИИ МЫТИЩЕНСКОГО ЛЕСОПАРКА

«ЛОСИНОГО ОСТРОВА»

Самойловская Н.А .

Федеральное государственное бюджетное научное учреждение «Всероссийский научноисследовательский институт экспериментальной ветеринарии имени Я.Р. Коваленко»

(ВИЭВ) (109428, Москва, Рязанский проспект, д. 24, кор. 1; ninasamoylovskaya@gmail.com Становление гельминтофаунистических комплексов любых групп животных зависит от природных и антропогенных факторов. Последние из года в год приобретают все большее значение. При этом снижается роль угодий как естественной кормовой базы для животных, но возрастает значение охотохозяйственной и ветеринарно-профилактической деятельности человека, поддерживающей численность и здоровье стада на заданном уровне. За счет интродукции и использования достижений биотехнии происходит расширение видового состава и увеличение численности животных, завозимых из других регионов без анализа и учета фауны гельминтов .

Контакты диких и домашних жвачных на пастбищных территориях приводят к общности состава гельминтов, что обнаруживается при вскрытии и при копрологических исследованиях (Анисимова, 1987; Власов и др.,2016;

Говорко и др., 1988; Горохов, Самойловская, 2016) .

В разных частях ареалов оленьих число регистрируемых видов меняется, но 4–5 облигатных встречается повсеместно, а присутствие других видов зависит от условий в конкретном регионе. Анализ фауны гельминтов диких и домашних жвачных в отдельных регионах показал общность видов у тех и других. Степень поражения животных при этом неодинакова, что зависит от биологических особенностей хозяев и паразитов, а также природных условий той или иной территории, способных обеспечить гельминту сохранность во внешней среде и возможность для дальнейшего развития (Говорко и др., 1988) .

Анализ литературных и оригинальных данных по видовой общности гельминтов домашних и диких копытных показал, что именно домашние животные являются хранителями и распространителями значительного числа паразитов диких зверей .

Известно, что дикие копытные подвержены различным паразитарным заболеваниям, которые часто оканчиваются летальным исходом или потерей ценных промысловых качеств, что причиняет большой экономический ущерб и снижает престиж национальных парков и заповедников (Анисимова, 1987;

Власов и др.,2016; Говорко и др., 1988; Горохов, Самойловская, 2016 и др.) .

Несмотря на то, что взрослые животные могут быть менее заражены, чем молодняк, они являются важным источником распространения инвазии и способствуют возникновению эпизоотии. При широком распространении паразитарных заболеваний возможна угроза передачи инвазии от диких к домашним животным и человеку (Анисимова, 1987; Власов и др.,2016; Говорко и др., 1988; Горохов, Самойловская, 2016) .

Северо–Западное Подмосковье, в состав которого входит национальный парк «Лосиный остров», расположено в центральной части Восточно–Европейской равнины в пределах Верхневолжской низины и Клинско–Дмитровской моренной гряды .

Значительная лесистость местности в сочетании с обилием болот и высокая естественная биопродуктивность растительности дали возможность использовать эти угодья для разведения диких животных. На этой основе еще в ранние советские годы был организован этот парк. Территорию Северо–Западного Подмосковья выделяем особо, т.к. в течение продолжительного времени проводили мониторинговые наблюдения за циркуляцией наиболее опасных для копытных инвазионных болезней (фасциолидозов копытных, метастронгилидозов кабанов) и за рядом других процессов экологического характера, происходящих в местных биоценозах (Самойловская, 2012а; Drуїdї et al., 1994, 2000). Наиболее интенсивное развитие хозяйства, работы по восстановлению и обогащению фауны начались в 60-х годах ХХ в. К этому времени была создана охрана, налажена борьба с хищниками, создан ветеринарно– санитарный контроль, после чего начался завоз животных (кабанов, лосей, пятнистых оленей и др.) из разных регионов Советского Союза, которые после передержки в вольерах выпускались на вольное содержание (Самойловская, 2012а; Drуїdї et al., 1994, 2000) .

Для борьбы с паразитарными болезнями сельскохозяйственных и диких животных предложены различные меры борьбы, включающие в себя контроль численности поголовья, уничтожение трупов животных, смена пастбищ, рациональное размещение биотехнических объектов и другие ветеринарно– санитарные и общехозяйственные мероприятия (Самойловская, 2012а; Drуїdї et al., 1994, 2000) .

Материалы и методы. Проведены: прижизненные и посмертные гельминтологические исследования диких животных ООПТ; зимне–весенний учет диких жвачных для определения очагов инвазии на исследуемых территориях; описание биотопов дефинитивных и промежуточных хозяев установленных паразитов; фото– и видео–документирование; микроскопирование материала, полученного различными паразитологическими методами исследований основных и промежуточных хозяев паразитов; статистический анализ полученных результатов и их анализ по литературным источникам (Скрябин,1928; Drуїdї et al., 1994, 2000) .

Результаты исследований и обсуждение. Прижизненные гельминтологические исследования проведены: Национальный парк «Лосиный остров» – пятнистые олени; лоси; кабаны и сельскохозяйственные животные, обитающие на территории Мытищинского лесопарка – козы, корова с теленком. Всего обследовано более 100 голов .

Исследованы пробы:

1. косули: пробы шерсти – 40, пробы фекалий – 50

2. пятнистые олени: пробы фекалий –1203

3. лоси: пробы фекалий – 198

4. кабаны: пробы фекалий – 65

5. сельскохозяйственные животные, обитающие на луговых пастбищах вблизи территорий ООПТ (к.р.с и м.р.с): пробы фекалий – 430 .

В исследуемых пробах фекалий зарегистрированы яйца и личинки гельминтов нематод семейства Trichostrongylidae и семейства Protostrongylidae, яйца трематод – Fasciola spp., ооцисты простейших – Eimeria spp.. В пробах шерсти – яйца и взрослые особи акариформных клещей Psoroptes spp .

Проведены гельминтологические вскрытия трупов животных по К.И. Скрябину (1928) 7 голов (2 лося и 5 пятнистых оленей). Лоси: 1 самец 4–5 лет, сбитый на Уральской улице г. Москвы, Яузский лесопарк, и 1 самец 1.5 года, Алешка (территория лосиной биостанции). Пятнистые олени: 4 самки 1.5–3 года – растерзали собаки, 1 самец – сеголетка .

Необходимо отметить, что зараженность гельминтами (ЭИ) у всех исследуемых видов животных фактически достигала от 70 до 100%. Интенсивность выделения у косуль (min-max) яиц нематод составляла от 0 до 16 экз. г/ф, личинок – 7–94 экз. г/ф, ооцист простейших – 2–27 экз. г/ф. У пятнистых оленей (min-max) яиц составляла от 0 до 15 экз. г/ф, личинок – 15–65 экз. г/ф, ооцист простейших – 0–14 экз. г/ф. У лосей (min-max) яиц составляла от 5 до 17 экз. г/ф, личинок – 13–195 экз. г/ф, ооцист простейших – 10–21 экз. г/ф. У сельскохозяйственных животных: козы – (min-max) яиц нематод составляла от 12 до 41 экз. г/ф, личинок – 21–216 экз. г/ф, ооцист простейших – 40–85 экз. г/ф; кабаны – (min-max) яйц составляла от 2 до 11 экз. г/ф, личинок – 26– 108 экз. г/ф, ооцист простейших – 10–38 экз. г/ф .

Проведен зимний учет поголовья диких копытных в парке «Лосиный остров» с целью определения очагов инвазии .

С контрольных участков лесных биотопов парка «Лосиный остров» собраны промежуточные хозяева личинок протостронгилид – наземные моллюски, Определен их количественный состав. Для определения их зараженности и дальнейших экспериментов, собранные моллюски содержались в маллакарии .

Фоновые моллюски «Лосиного острова»: Аgriolimax reticulatus; A. agrestis;

Bradybaena fruticum; Cochlicopa lubrica; Euomphalia strigella; Helicolimax pellucidus; Succinea putris; Zenobiella rubiginosa и Zonitoides nitidus (Самойловская, 2012) .

Установлены общие виды моллюсков – промежуточных хозяев протостронгилид – на исследуемых территориях. Это виды Bradybaena fruticum и Succinea putris, интенсивность инвазии которых достигала от 1 до 7 экземпляров личинок протостронгилид на одного моллюска .

Наиболее эффективным методом снижения численности гельминтов у животных является применение кормов, включающих антигельминтики (Самойловская, 2012а) .

Терапия и профилактика гельминтозов позволяет не только освободить животных от паразитов, но и предохранить окружающую среду от заражения инвазионными элементами. Как отмечал академик К.И. Скрябин (1946): «Дегельминтизация – это метод борьбы не только с глистными инвазиями, но и с бактериальными болезнями, способ воспрепятствовать микробам, проникать в стенки кишечника при посредстве тех ворот, которые гостеприимно открываются инфекционным началам со стороны паразитических червей» .

Применение лекарственных кормов является сложной задачей, т.к. у диких животных очень остро развито обоняние, и они часто отказываются от кормов, где содержатся препараты со специфическим вкусом и запахом. Кроме того, кормолекарственные смеси должны быть не только без специфического вкуса и запаха, но и высокоэффективными и не токсичными, безопасными не только для животных и их потомства, но и для человека и окружающей среды .

Огромный вред здоровью человека могут нанести и сами антигельминтики, накапливающиеся в продуктах животного происхождения. Поэтому возникает еще одна задача, на которую необходимо обратить особое внимание – сроки выведения остаточных количеств препарата из организма животных .

При постановке диагноза – «Гельминтоз», подбор препарата необходимо проводить с учетом терапевтического действия и оптимального способа применения для данного вида животных .

В настоящее время практически отсутствуют лекарственные формы антигельминтиков, удобные для добровольного поедания дикими животными, которые были бы эффективными, безопасными и экономически выгодными .

По результатам исследований, можно заключить, что ивермектин (субстанция) в терапевтической дозе 0.2 мг/кг при пероральном введении не оказывает отрицательного влияния на эмбриональное развитие крыс, соответственно его можно применять для профилактики паразитозов у диких копытных животных, согласно «Методическим положениям по профилактике паразитарных болезней у лосей на природных территориях России» (Самойловская, 2012, 2012а) .

Литература

Анисимова Е.И. Соврем. пробл. профилактики зооноз. болезней и пути их решения. / Минск,1987. С.183–184 .

Власов Е.А., Малышева Н.С., Самойловская Н.А., Успенский А.В., Горохов В.В. Методические положения по организации изучения гельминтофауны млекопитающих на особо охраняемых природных территориях // Российский паразитологический журнал. 2016. Т. 37. № 3. С. 409–413 .

Говорко Я., Маклакова Л.П., Митух Я., Пельгунов А.Н., Рыковский А.С., Семенова М.К., Сонин М.Д., Эрхардова-Котрла Б., Юрашек В. Гельминты диких копытных Восточной Европы // М.: Наука, 1988. 208 С .

Горохов В.В., Самойловская Н.А. Прогноз эпизоотической ситуации по основным гельминтозам сельскохозяйственных животных в России на 2016 год // Российский паразитологический журнал. 2016. Т. 35. № 1. С. 38–40 .

Самойловская Н.А. Основы профилактики паразитарных болезней у диких животных // Матер. докл. Междунар. науч.-практ. конф. «Экологические проблемы использования природных и биологических ресурсов в сельском хозяйстве». Екатеринбург, 2012. С.199–201 .

<

–  –  –

Собака (Canis familiaris dom.) – типичный представитель фауны млекопитающих городской среды и урбанизированных территорий. Популяции домашних собак, состоящих из разных породных групп, достаточно многочисленны в условиях мегаполиса Ташкента. Они, по общему признанию паразитологов, создают условия для существования большого числа экто– и эндопаразитов, имеющих медико–санитарное и ветеринарное значение. Исследования паразитарных сообществ собак на современной территории мегаполиса Ташкента ранее не проводились .

Целью нашей работы является изучение видового состава нематод собак, а также особенностей их распространения на исследуемой территории .

Материал и методы. Материал для исследования был собран в течение 2016–2018 гг. Всего обследовано 32 особей собак разных возрастов и 65 комплектов отдельных органов из районов г. Ташкента. Для обнаружения, сбора и фиксации нематод использовали стандартные методы вскрытия животных .

Видовое определение проводилось по описаниям, содержащимся в литературе (Козлов, 1977; Anderson, 2000) .

Результаты и обсуждение. Проведенные исследования позволили установить, что из 32 обследованных собак нематоды обнаружены у 30, что составляет 96.6% экстенсивности инвазии. Интенсивность инвазии нематодами колебалось от 5 до 105 экз .

У зараженных собак зарегистрировано 12 видов нематод, принадлежащих к 4 отрядам класса Nematoda: Capillaria plica (Rudolphi, 1819), Trichocephalus vulpis (Frоelich, 1789), Dioctophyme renale (Goeze, 1782), Ancylostoma caninum (Ercolani, 1859), Uncinaria stenocephala (Railliet, 1854), Toxascaris leoninа (Linstow, 1902), Toxocara canis (Werner, 1782), Spirocerca lupi (Rudolphi, 1809), Physoloptera praeputeiale (Linstow, 1888), Rictularia affinis (Jgerskiold, 1904), Dirofiliaria immitis (Leidy, 1856), Dirofiliaria repens (Railliet et Henry, 1911) .

Большинство выявленных паразитов являются типичными представителями гельминтофауны как собаки, так и плотоядных собачьих в целом, что дает основание предполагать наличие идентичных гельминтов и у других представителей этого семейства животных – шакала, волков и лисиц .

Паразитические нематоды собак, относящиеся к отряду Trichocephalida Skrjabin et Schulz, 1928, представлены тремя видами: Trichocephalus vulpis, Capillaria plica и Dioctophyme renale, которые паразитируют в толстом отделе кишечника, мочевом пузыре и почках соответственно .

Отряд Strongylida Railliet et Henry, 1913 представлен двумя видами нематод: Ancylostoma caninum и Uncinaria stenocephala – паразитами тонкого кишечника собак. Эти виды достаточно широко распространены среди исследуемых животных мегаполиса Ташкента .

Нематоды отряда Ascaridida Skrjabin et Schulz, 1940 широко распространены среди молодняка и взрослых собак. Обнаруженные виды – Toxascaris leoninа и Toxocara canis – относятся к доминирующим паразитам тонкого кишечника и вызывают серьезные заболевания домашних собак. Личинки этих нематод могут паразитировать и у человека .

Отряд Spirurida (Railliet, 1914) наиболее богато представлен в видовом отношении. Отмечены 5 видов нематод – Spirocerca lupi, Pysoloptera praeputiale, Rictularia affinis, Dirofilaria immitis и Dirofilaria repens. Локализация этой группы нематод довольно разнообразна и в зависимости от ее характера они, в свою очередь, могут быть распределены на группы: паразиты желудка и стенок пищевода (S. lupi); паразиты желудка и кишечника (Ph .

praeputiale); паразиты тонкого кишечника (R. affinis); паразиты желудочков сердца (D. immitis) и паразиты подкожной клетчатки (D. repens) .

По характеру биологического цикла зарегистрированные нами 12 видов нематод домашней собаки могут быть разделены на две группы .

1. Биологический цикл протекает без участия промежугочных хозяев. Таким путем развиваются виды родов Trichocephalus, Anсylostoma, Uncinaria, Toxascaris, Toxocara. Собаки заражаются при поедании пищи, содержащей их инвазионные яйца .

2. Биологический цикл осуществляется с участием промежуточных хозяев и их сменой. Такая особенность развития свойственна видам нематод родов Capillaria, Dioctophyme, Spirocerca, Physoloptera, Rictularia и Dirofiliaria .

В качестве промежуточных и резервуарных хозяев исследуемых нематод домашней собаки зарегистрированы различные виды беспозвоночных и позвоночных животных. В одном случае, собаки заражаются при заглатывании инвазированных личинками промежуточных или резервуарных хозяев. В другом, заражение собак происходит при укусе комаров, содержащих в хоботке инвазионных личинок нематод рода Dirofiliaria (Anderson, 2000; Сапаров, 2016) .

Анализируя видовой состав нематод домашней собаки мегаполиса Ташкента, следует отметить, что многие виды представляют серьезную угрозу и для здоровья человека. Нематоды родов Dioctophyme, Ancylostoma, Uncinaria, Toxocara, Toxascaris, Spirocerca и Dirofiliaria в личиночной или зрелой стадии могут паразитировать у человека, особенно у детей (Бронштейн, Токмалаев, 2004) .

Заключение. В условиях мегаполиса Ташкента у домашней собаки нами идентифицированы 12 видов нематод, которые имеют медико–санитарное и ветеринарное значение. Все это требует расширения комплексных исследований сообщества нематод животных мегаполисов и организации развернутой системы мониторинга паразитарного загрязнения окружающей среды .

Литература

Бронштейн А.М., Токмалаев А.К. Паразитарные болезни человека. Протозоозы и гельминтозы / Москва, 2004. 208 с .

Козлов Д.П. Определитель гельминтов хищных млекопитающих СССР / Москва: Наука, 1977. 276 с .

Сапаров К.А. Фауна, распространение и экология филиариат птиц и млекопитающих Узбекистана. дисс....докт. биол. наук. / Ташкент, 2016. 227 с .

Anderson R.C. Nematoda parasites of Vertebrates their development and transmission / New York: CAB International, 2000. 650 p .

ВИДОВОЕ РАЗНООБРАЗИЕ НЕМАТОД ОТРЯДА

SPIRURIDA У КАРПООБРАЗНЫХ РЫБ ВОДОЕМОВ

РЕКИ СЫРДАРЬИ

Сафарова Ф.Э., Акрамова Ф.Д., Шакарбоев Э.Б .

Институт зоологии АН РУз, ул. Багишамол, 232б, Ташкент, 100053, Узбекистан;

Бассейн реки Сырдарьи представляет собой природно–географический комплекс на трансграничной территории, в котором находятся различные по экологическим условиям водоемы. В связи с интенсивной хозяйственной деятельностью человека, связанной с использованием водных ресурсов, происходят заметные качественные и количественные изменения биоценозов и ихтиоценозов. При этом неизбежно возникают паразитарные болезни рыб, которые приводят к снижению численности их ценных видов и ухудшению эпизоотической ситуации водоемов. Паразитарные заболевания рыб не только причиняют весомый экономический ущерб, связанный со снижением рыбной продуктивности, но и опасны для здоровья человека .

Целью настоящей работы является изучение фауны и распространения нематод отряда Spirurida у рыб водоемов реки Сырдарьи .

Материал и методы. Исследования проводились в 2013–2018 годах в водоемах бассейна р. Сырдарьи, территориально охватывающие Сырдарьинскую, Ташкентскую и Джизакскую области .

Сбор и изучение спирурид рыб проводились обще известными методами (Скрябин, 1928; Быховская-Павловская, 1985). Исследовано 2635 экз. карпообразных рыб 15 видов, относящихся к семействам: Cyprinidae – 12, Cobitidae

– 3. Кроме того, проводились неполные вскрытия отдельных органов 1846 экз. рыб, приготовлено 1560 временных и постоянных тотальных препаратов .

Камеральная обработка и определение видовой принадлежности спирурид осуществлено в лаборатории Общей паразитологии Института зоологии АН РУз с использованием соответствующих определителей паразитов пресноводных рыб (Быховская-Павловская, 1985) и Каталогов (Пугачев, 2004) .

Результаты и обсуждение. Нами установлено, что спируриды карпообразных рыб в бассейне реки Сырдарьи представлены 16 видами, принадлежащими к подотрядам Spirurata, Camallanata и Gnatastomata: Rhabdochona gnedini Skrjabin, 1946, Rh. chodukini Osmanov, 1957, Rh. denudata (Dujardin, 1845), Rh. sulaki Saidov, 1953, Rh. longicauda Dzhalilov, 1964, Rh. fortunatovi Dinnik, 1933, Rh. hellichi (ramek, 1901), Desmidocercella numidica Seurat, 1920, Camallanus lacustris (Zoega, 1776), C. truncatus (Rudolphi, 1814), Spirocamallanus siluri Osmanov, 1964, Phylometra obturans (Prenant, 1886), Ph. ovata (Zeder, 1803), Ph. abdominalis Nybelin, 1928, Ph. intestinalis Dogiel et Bychowsky, 1934, Gnatostoma hispidum Fedtchenko, 1872 .

Значительным видовым разнообразием в водоемах реки Сырдарьи характеризуется подотряд Spirurata Нами зарегистрировано 8 видов, принадлежащих к 2 семействам (Rhabdochonidae – 7 видов, Desmidocercidae – 1), которые отмечены у большинства видов карпообразных в естественных и искусственных водоемах Сырдарьи. Почти аналогичным видовым разнообразием характеризуется подотряд Camallanata – 7 видов из семейств Camallanidae и Phylometriidae. Подотряд Gnatostomata представлен 1 видом – Gnatostoma hispidum (larvae) .

Распределение указанных сообществ спирурид в регионе зависит от ряда общеизвестных биотических и абиотических факторов. Заражение рыб происходит преимущественно через пищевые каналы хозяев .

В последние годы наметилось интенсивное использование водоемов р .

Сырдарьи для разведения рыб, главным образом, карпообразных. В этой связи, перед нами поставлена задача – уточнить видовое разнообразие нематод отряда Spirurida и их распространение. У карпообразных рыб нами зарегистрировано 16 видов спирурид, паразитирующих в разных стадиях развития .

Полученные результаты наводят на мысль, что наиболее оптимальные условия для функционирования рассматриваемых нематод, вероятно, имеются в водоемах р. Сырдарьи. Это, в частности, обилие ряда групп беспозвоночных – обитателей водных экосистем, являющихся промежуточными хозяевами паразитов карпообразных. Скопление на этих территориях водно–болотных птиц и млекопитающих способствуют циркуляции соответствующих групп видов спирурид .

Видовое разнообразие спирурид – эндогельминтов карпообразных, в исследуемом регионе достаточно богато и разнообразно. Это предполагает дальнейшее проведение мониторинга паразитологической ситуации в конкретных водоемах и необходимость учитывать ее результаты при разработке профилактических мероприятий .

Литература

Быховская-Павловская И.Е. Паразиты рыб. Руководство по изучению / Л.: Наука, 1985 .

121 с .

Пугачев О.Н. Каталог паразитов пресноводных рыб Северной Азии (Нематоды, скребни, пиявки, моллюски, ракообразные, клещи) // Труды зоологического института РАН, Санкт-Петербург, 2004. Том 304. С. 244 .

Скрябин К.И. Методы полных гельминтологических вскрытий позвоночных, включая и человека / М.: Изд. 1-го МГУ, 1928. 45 с .

МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКАЯ ДИАГНОСТИКА

МЕТАЦЕРКАРИЙ ТРЕМАТОД ОЗЕРНОЙ ЛЯГУШКИ

ИЗ ЗАПОВЕДНИКА «ПРИВОЛЖСКАЯ ЛЕСОСТЕПЬ»

ПО МАРКЕРАМ 28S rRNA И ITS2 Свинин1 А.О., Иванов2 А.Ю., Башинский3 И.В., Ермаков2 О.А .

Марийский государственный университет, 424000, г. Йошкар-Ола, пл. Ленина, 1, Россия;

–  –  –

Фауна трематод амфибий Среднего Поволжья включает около 40 видов (Кириллов и др., 2012). Из всех амфибий наиболее богатым списком трематод обладает озерная лягушка, Pelophylax ridibundus (Pallas, 1771), у которой зарегистрировано в данном регионе 36 видов. Для 10 видов трематод озерная лягушка выступает в качестве метацеркарного хозяина и для 3 видов в качестве мезоцеркарного (представители рода Strigea). Из них для 6 видов в «GenBank NCBI» имеются последовательности гена 28S rRNA, а для 4 имеются последовательности у близких видов, что делает возможным изучение метацеркарных хозяев с помощью молекулярно-генетических методов диагностики. В данной работе мы приводим сведения по молекулярно-генетическому разнообразию метацеркарий трематод из озерной лягушки по маркерам 28S rRNA и ITS2, которое может быть использовано в качестве источника дополнительных данных наряду с гельминтологическим вскрытием и изучением морфологии метацеркарий .

Нами были изучены метацеркарии трематод у головастиков (n=18), полувзрослых (n=4) и взрослых (n=2) особей озерной лягушки, пойманных в заповеднике «Приволжская лесостепь» (участок «Островцовская лесостепь») в 2016 и 2017 гг. Изученные метацеркарии трематод локализовались преимущественно в бедренных мышцах, но также в языке, сальнике тонкой кишки и коже. При проведении ПЦР использовались праймеры для последовательностей 28S rRNA и ITS2, разработанные для трематод (Tkach et al., 2000; 2003;

Wilson et al., 2005). С целью дальнейшего анализа видовой принадлежности данные фрагменты были отсеквенированы и сопоставлены с имеющимися последовательностями в «GenBank NCBI» с помощью алгоритма BLAST .

В результате у озерной лягушки «Островцовской лесостепи» найдено четыре различных генетических варианта метацеркарий. Для трех данных генетических вариантов найдены соответствия в «GenBank NCBI» с высокой степенью надежности (99–100%) по 28S rRNA, которые соответствуют трем видам: Paralepoderma cloacicola (Lhe, 1909) Dollfus, 1950, Macrodera longicollis (Abildgaard, 1788) Lhe, 1899, Opisthioglyphe ranae (Frlich, 1791) Looss, 1899. Для одного вида мы не нашли строгого соответствия и он лишь на 97% был схож с Gorgodera cygnoides (Zeder, 1800). При этом для ITS2 мы не нашли соответствия в базах данных. Таким образом, мы получили новые последовательности ITS2 для трех видов трематод, что может быть использовано для идентификации данных видов в будущих исследованиях .

Все три достоверно идентифицированных вида имеют триксенный жизненный цикл. Окончательным хозяином для Paralepoderma cloacicola и Macrodera longicollis служит обыкновенный уж, Natrix natrix (Linnaeus, 1758) .

Окончательным хозяином Opisthioglyphe ranae являются амфибии: заражение взрослых происходит при поедании сеголеток своего или других видов (Кириллов и др., 2012). В качестве первого промежуточного хозяина для Paralepoderma cloacicola и Macrodera longicollis отмечен вид Planorbis planorbis (Linnaeus, 1758). Для Opisthioglyphe ranae промежуточными хозяевами являются брюхоногие моллюски рода Lymnaea (Lamarck, 1799) .

Впервые для Пензенской области отмечена Macrodera longicollis, тогда как другие виды были отмечены для озерной лягушки ранее (Чихляев и др., 2016) .

Работа выполнена в рамках базовой части государственного задания ФГБОУ ВО “Пензенский государственный университет” в сфере научной деятельности на 2017–2019 гг. (проект 6.7197.2017/БЧ). Исследования поддержаны грантами РФФИ № 18-34-00059 .

Литература

Кириллов А.А., Кириллова Н.Ю., Чихляев И.В. Трематоды наземных позвоночных Среднего Поволжья / Тольятти: Кассандра, 2012. 329 с .

Чихляев И.В., Иванов А.Ю., Каменецкий А.С., Быстракова Н.В., Файзулин А.И. О гельминтах озерной лягушки Pelophylax ridibundus (Pallas, 1771) в г. Пензе // Современные концепции экологии биосистем и их роль в решении проблем сохранения природы и природопользования: Материалы Всероссийской (с международным участием) научной школы-конференции, посвященной 115-летию со дня рождения А.А. Уранова. 2016. С. 198–200 .

Tkach V.V., Littlewood D.T.J., Olson P.D., Kinsella J.M., Swiderski Z. Molecular phylogenetic analysis of the Microphalloidea Ward, 1901 (Trematoda: Digenea) // Systematic Parasitology, 2003. Vol. 56. P.1–15 .

Wilson W.D., Johnson P.T.J., Sutherland D.R., Monй H., Loker E.S. A molecular phylogenetic study of the genus Ribeiroia (Digenea): Trematodes known to cause limb malformations in amphibians // Journal of Parasitology, 2005. Vol. 91. P.1040–1045 .

–  –  –

Институт систематики и экологии животных СО РАН, 630091, г. Новосибирск, ул. Фрунзе, 11, Россия; serbina_elena_an@mail.ru Исследования моллюсков семейства Bithyniidae в бассейне самого большого естественного водоема Барабинской низменности – озера Чаны (юг Западной Сибири) показало, что дефинитивными хозяевами трематод большинства видов являются в основном птицы (Сербина, 2004). Сведения о зараженности водно-болотных птиц отдельными семействами представлены нами ранее: Prosthogonimidae (Сербина, 2005), Psilostomidae (Сербина, 2006), Plagiorchiidae (Водяницкая, Сербина, 2008), Notocotylidae (Сербина, Бонина, 2015). Цель настоящего исследования – представить видовой состав марит трематод в бассейне оз. Чаны, выявленных при наших сборах .

Гельминтологические исследования птиц проведены в бассейне озера Чаны в 1996 –2007 гг. Птицы для исследования добыты охотниками в устьях рек Чулым и Каргат, впадающих в оз. Малые Чаны; оз. Фадиха, оз. М.Чаны –залив Золотые Россыпи. Были исследованы методом неполного гельминтологического вскрытия 350 птиц, относящихся к 25 видам 6 отрядов: Anseriformes (гусеообразные) – гуся серого Anser anser (15), кряквы Anas platyrhynchos (63), кряквы домашней Anas platyrhynchos dom. (1), серой утки A. strepera (35), свиязи A. penelope (3), шилохвостей A. acuta (3), чирка–трескунка (A. querquedula) (15), чирка–свистунка (A. crecca) (15), широконоски A. clypeata (12), красноголовая чернеть Authya ferina (37), хохлатая чернеть – A. fuligula (L.) (2); луток Mergus albeiius (1); Charadriiformes (ржанкообразные) – хохотуньи Larus cachinnans (4.), черноголового хохотуна L. ichthyaetus (1), озерной чайки L. idibundus (2), шилоклювки Recurvirostra avosetta (5), Podicipediformes (поганки) – большой поганки Podiceps cristatus (4), серощекой поганки P. grisegena (4), черношейной поганки P. nigricollis (2), Ciconiiformes (голенастые) – большой выпи Botaurus stellaris (4), Gruiformes (журавлеобразные) – лысуха Fulica atra (116) и погоныш Porzana porzana (1), Passeriformes (воробьинообразные) – грач Corvus frugilegus (1), серая ворона C. cornix (1), обыкновенный скворец Sturnus vulgaris (2). У части выборки обследованы только фабрициевые сумки. Видовая принадлежность птиц определена сотрудниками Института систематики и экологии животных Сибирского отделения РАН – кандидатами биологических наук А.П. Яновским и А.К. Юрловым .

Изучено 16497 марит, которые относятся к 32 видам 12 семейств: 1) Prosthogonimus ovatus Rudolphi, 1803; 2) P. cuneatus Rudolphi, 1809; 3) Schistogonimus rarus Braun, 1901 (Prosthogonimidae Lhe, 1909); 4) Notocotylus imbricatus (Looss, 1893), Szidat, 1935; 5) N. parviovatus Yamaguti, 1934; 6) Notocotylus gibbus (Koss, 1911); 7) N. attenuatus (Rud., 1809); 8) Catatropis sp .

(Notocotylidae Lhe, 1909); 9) Psilochasmus oxyurus (Creplin, 1825); 10) Apopharynx bolodes (Braun 1902) Lhe, 1909; 11) Sphaeridiotrema globulus Rudolphi, 1819; 12) Psilotrema tuberculata Filippi, 1857; 13) Р. simillimum Muhling, 1898 (Psilostomidae Odhner, 1913); 14) Moliniella ansceps Molin, 1859; 15) Echinoparyphium aconiatum Dietz, 1909; 16) E. recurvatum Linstow, 1873; 17) Echinostoma chloropodis Zeder, 1800; 18) E. grandis Baschkirova, 1946; 19) E. revolutum Frohlich, 1808; (Echinostomatidae (Looss, 1899) Dietz, 1909); 20) Plagiorchis elegans Rudolphi, 1802 (Plagiorchiidae Lhe, 1901); 21) Cotylurus cornutus (Rud., 1808); 22) C. hebraicus Dubois, 1934; 23) Strigeidae sp. вероятно Ophiosoma patagiatum (Creplin, 1846) (Strigeidae Railliet, 1919); 24) Cyclocoelum sp .

(Сyclocoelidae Kossack, 1911); 25) Echinochasmus coaxatus (Dietz, 1909) (Echinochasmidae Odhner, 1911); 26) Cyathocotyle prussica Muhling, 1896;

27) Cyathocotyle opаca (Wisniewski, 1934, Vojtek, 1971); 28) C. bushiensis Khan, 1962 (Cyathocotilidae (Muehling, 1898) Poche, 1925); 29) Leyogonimus polyoon (Linstow, 1887); 30) L. arenula Creplin, 1825 (sin.: Phaneropsolus arenula (Creplin, 1825) (Lecithodendriidae Odhner, 1911); 31) Dendritobilharzia pulverulenta (Braun, 1901) (Schistosomatidae Loss, 1899); 32) Lеucochloridium sp. (Brachylaemidae Stiles et Hassal, 1898) .

Мариты обнаружены у 19 видов обследованных птиц. У большой поганки обнаружены мариты одного вида – E. coaxatus (25). У ржанкообразных обнаружено два вида трематод (1 и 2), оба у серебристой чайки, хохотуньи. У гусеообразных мариты трематод 14 видов обнаружены у десяти видов: у гуся серого (виды 1, 2, 3); у кряквы (1, 2, 3, 4, 5, 7, 8, 15, 16, 19, 21); у кряквы домашней (11); у серой утки (2, 7, 8, 15, 19, 21); у свиязи (1, 19); у чирка– трескунка (3, 7, 8, 9, 15, 16, 19, 21); у чирка-свистунка (1); у широконоски (1, 2, 21); у лутка (21); у красноголовых чернетей (1, 2, 3, 4, 7, 8, 11, 15, 16, 19, 20, 21); у хохлатых чернетей (1, 2, 3). У воробьинообразных обнаружены мариты трех видов: у серой вороны (1, 2, 20); у грача (1, 2, 20); у скворцов обыкновенных (1, 20). У журавлеобразных обнаружены мариты 28 видов – у погоныша (5, 17, 19, 30) и у лысух (все кроме 9, 21, 23 и 25). Следует отметить, что половозрелые мариты L. аrenula и C. bushiensis были выращены при экспериментальном заражении однодневного птенца лысухи. Мариты Strigeidae spp .

выявлены у большой выпи, с максимальной интенсивностью инвазии 158 экз .

Специфичный для выпей представитель этого семейства Ophiosoma patagiatum Creplin,1846, ранее отмечен у выпи из бассейна оз. Чаны (Быховская-Павловская, 1953) .

Марита C. opаca – впервые обнаружена в естественных условиях на территории России. Лысуха впервые зарегистрирована в качестве окончательного хозяина вида C. opаca. Трематоды M. ansceps впервые обнаружены у лысух в бассейне оз. Чаны .

Работа выполнена при поддержке программы фундаментальных научных исследований на 2013–2020 гг., проект № VI.51.1.5 .

Литература

Водяницкая С.Н., Сербина Е.А. Зараженность птиц трематодами сем. Plagiorchiidae в бассейне оз. Чаны (юг Западной Сибири) // Биоразнообразие и экология паразитов наземных и водных ценозов. Москва, 2008. С. 60–62 .

Сербина Е.А. Церкарии трематод в моллюсках семейства Вithyniidae (Gastropoda:

Prosobranchia) из бассейна оз. Малые Чаны (юг Западной Сибири) // Сибирский экологический журнал. 2004. № 4. С. 457–462. Serbina Е.А Cercariae of Trematodes in Snails of Bithyniidae family (Gastropoda: Prosobranchia) from the Basin of the Malye Chany Lake (South of West Siberia) // Siberian Journal of Ecology. 2004. N 4. P. 457– 462 .

Сербина Е.А. Распространение трематод семейства Prosthogonimidae в речных и озерных экосистемах юга Западной Сибири // Паразитология. 2005. № 39 (1). С. 50–

65. Serbina E.A. Distribution of trematodes of the family Prosthogonimidae in river and lake ecological systems in the south of the Western Siberia // Parazitologiya. 2005 .

39(1). P. 50–65 .

Сербина Е.А. Распространение трематод семейства Psilostomatidae Odhner, 1913 в Западной Сибири // Сибирский экологический журнал. 2006. № 4. С.409–418 .

Serbina E.A. Prevalence of Trematodas Family Psilostomatidae Odhner, 1913 in the South of West Siberia // Siberian Journal of Ecology. 2006. V. 13. № 4. P. 409–418 .

Сербина Е.А., Бонина О.М. Динамика очагов нотокотилезов птиц в экосистеме озера Чаны (Западная Сибирь) за последние 80 лет // Российский паразитологический журнал. Москва. 2015. Вып. 3. С. 29–36. Serbina E.A., Bonina O.M. Dynamics of foci of bird notocotylidosis in the ecosystem of Lake Chany (Western Siberia) in the last 80 years // Russian Journal of Parasitology. Moscow. 2015. Vol. 3. P. 29–36 .

DOI:10.12737/13271

ЗАРАЖЕННОСТЬ МЕТАЦЕРКАРИЯМИ ТРЕМАТОД

МЫШЦ АБОРИГЕННЫХ И ЧУЖЕРОДНЫХ

КАРПОВЫХ РЫБ РЕК БАССЕЙНА СРЕДНЕЙ ОБИ

Симакова1 А.В., Ходкевич1 Н.Е., Бабкин2 А.М., Интересова1,2 Е.А .

Национальный исследовательский Томский государственный университет, 634050, г. Томск, пр-т Ленина, 36, Россия, ylitki@sibmail.com Новосибирский филиал ФГБНУ «Госрыбцентр», 630091, г. Новосибирск, ул. Писарева, 1,

–  –  –

Карповые рыбы могут быть как промежуточными, так и окончательными хозяевами для многих видов трематод. Помимо метацеркарий кошачьей двуустки в мышцах карповых могут встречаться и другие виды трематод, патогенные и непатогенные для человека .



Pages:     | 1 || 3 |



Похожие работы:

«РОССИЙСКИЙ М ОРСКОЙ РЕГИС ТР СУД ОХОД СТВА Электронный аналог печатного издания, утвержденного 03.10.17 ПРАВИЛА КЛАССИФИКАЦИИ И ПОСТРОЙКИ МОРСКИХ СУДОВ Часть IX М ЕХАНИЗМ Ы НД № 2-020101-104 Санкт-Петербург украшения для одежды Правила классификации и постройки морских судов Российского морского регистра судоход...»

«Задание 2. Оценки экономистов показывают, что в настоящее время мировой дефицит нефтяных моторных топлив составляет порядка 10 млн . т. Одной из главных альтернатив таким топливам является пропан-бутановая смесь, использование которой в последние годы резко увеличивается в связи с ростом цен на бензин, истощением запасов нефти, уху...»

«CAAF/09-WP/22 Международная организация гражданской авиации 9/10/09 РАБОЧИЙ ДОКУМЕНТ КОНФЕРЕНЦИЯ ПО АВИАЦИИ И АЛЬТЕРНАТИВНЫМ ВИДАМ ТОПЛИВА Рио-де-Жанейро, Бразилия, 16–18 ноября 2009 года Пункт 4 повестки дня. Производство и инфраструктура ИСПОЛЬЗОВАНИЕ АНАЛИЗА ЗАТРАТ-ВЫГОД ДЛЯ ИНВЕСТИЦИЙ НА СОЗДАНИЕ АЛЬТЕРНАТИВНО...»

«Вестник Томского государственного университета. Биология. 2013. № 3 (23). С. 83–90 УДК 597.95 + 575.222.72+591.551 doi: 10.17223/19988591/23/7 В.В. ярцев, В.Н . Куранова Томский государственный университет (г. Томс...»

«УДК 615.281:577.1 АНТИБАКТЕРИАЛЬНАЯ АКТИВНОСТЬ ХИТОЗАНА И ЕГО ПРОИЗВОДНЫХ С.Н. Куликов, Ю.А. Тюрин, А.В. Ильина*, А.Н. Левов*, С.А. Лопатин*, В.П . Варламов* Казанский научно-исследовательский институт эпидемиологии и микробиологии Роспотребнадзора, Казань, Россия * Центр "Биоинженерия" РАН, Москва, Россия Введение Хитозан природ...»

«Публикация Хельсинского Университета Технологии по тематике "Вода и Развитие" Публикация Хельсинского университета технологии по тематике "Вода и развитие" Публикация Хельсинского университета технологии по тематике "Вода и развитие" Публикация Хельсинского университета технологии по тематике "Вода и развитие"Центрально-азиатс...»

«16 РУССКОЯЗЫЧНАЯ ВЕРСИЯ СОХРАНЕНИЕ КОСТНОГО ГРЕБНЯ ПОСЛЕ ЭКСТРАКЦИИ Д-Р ЯНИВ МАЙЕР СОХРАНЕНИЕ КОСТНОГО ГРЕБНЯ ПОСЛЕ ЭКСТРАКЦИИ На примере серии исследований на По разнообразным причинам собаках и людях в работе Хюрцлера удаление зуба становится первым и Фикля (Hurzeler and Fickl) с...»

«УТВЕРЖДАЮ Генеральный директор ОАО "Верхневолжскнефтепровод" _ /Ю.Л. Левин/ "" _2014г. ДОКУМЕНТАЦИЯ ПО ЗАКУПКЕ ОТКРЫТЫЙ ЗАПРОС КОТИРОВОК ЛОТ № 226-ОЭБИРП-2014 "ИСКУССТВЕННОЕ ВОСПРОИЗВОДСТВО ВОДНЫХ БИОЛОГИЧЕСКИХ РЕСУРСОВ В ЦЕЛЯХ КОМПЕНСАЦИИ УЩЕРБА В РЕЗУЛЬТАТЕ НЕГАТИВНОГО ВОЗДЕЙСТВИЯ НА ВО...»

«Фармацевтический рынок РОССИИ Выпуск: февраль 2015 розничный аудит фармацевтического рынка РФ – февраль 2015 события фармацевтического рынка – март 2015 Информация основана на данных розничного аудита фармацевтического рынка РФ DSM Group, система менеджмента к...»

«Author: Погребняк Николай Иванович Как медведи приспособились к Арктике после Потопа Статья возникла из переписки с сельским священнослужителем. Однажды в письме он задал вопрос: "Креационисты утверждают, что после потопа тёплый климат на земле из...»

«ДОБРЖАНСКАЯ Анна Валерьевна СОСТАВ И СВОЙСТВА ТОНКИХ НИТЕЙ ЗАПИРАТЕЛЬНЫХ МЫШЦ МИДИИ CRENOMYTILUS GRAYANUS 03.03.04 клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологическ...»

«Нефедова Наталия Сергеевна МИНОРНЫЕ КОМПОНЕНТЫ МЕТАБОЛИЗМА В ИССЛЕДОВАНИИ МЕЖМОЛЕКУЛЯРНОГО ВЗАИМОДЕЙСТВИЯ 03.01.04 – Биохимия Автореферат диссертации на соискание ученой степени кандидата медицинских наук Челябинск 2013 Работа выполнена на кафедре фундаментальной и клинической биохимии с л...»

«О НЕКОТОРЫХ ФУНДАМЕНТАЛЬНЫХ ПРОБЛЕМАХ ГИДРОХИМИИ И ГИДРОЭКОЛОГИИ В СВЕТЕ РЕАЛИЗАЦИИ ВОДНОЙ СТРАТЕГИИ РОССИЙСКОЙ ФЕДЕРАЦИИ НА ПЕРИОД ДО 2020 ГОДА Никаноров А.М. Институт водных проблем РАН, Гидрохимический отдел, г. Р...»

«Ла б о р ато р н ы е животные 2018 №3 дЛя научных иссЛедований https://doi.org/10.29296/2618723X-2018-03-01 Активация эндокринной системы семенников мышей линии С57BL/6J в ответ на сексуальный стимул Т.Г. Амстиславская1, 2, доктор биологических наук, доцент, зав. лаб...»

«ТРЕТЬЯ НАУЧНАЯ ШКОЛА МОЛОДЫХ УЧЕНЫХ И СПЕЦИАЛИСТОВ ПО РЫБНОМУ ХОЗЯЙСТВУ И ЭКОЛОГИИ 20 апреля 2018 Бионическое моделирование слабоэлектрических рыб Ольшанский В.М., Сюэ Вэй Харбинский инженерный университет Вторая школа по рыбному хозяйству 24 апреля 2015 Про э...»

«.-лз^шгазэ*. ТЗМы-Т,-ln. Расчет тарифов с 03.09.2018 J Статьи Подготовка будущих Подготовка будущих Кружок Занятия спортивной Занятия первоклассников к первоклассников к Умники и гимнастикой хореографией школе школе Умницы (индивидуальные) 3/пл пед. 7488,00 7488,00 468,00 3510,00 3240,00 Отпускные педагогов 75,07 563,04 519,...»

«ЭКОЛОГИЧЕСКИЕ И ГЕНЕТИЧЕСКИЕ ХАРАКТЕРИСТИКИ ДОМОВЫХ И КУРГАНЧИКОВЫХ МЫШЕЙ (MUS MUSCULUS S. STR. И MUS SPICILEGUS PETENYI), ОПРЕДЕЛИВШИЕ ИХ ОТНОСИТЕЛЬНЫЙ ЭВОЛЮЦИОННЫЙ УСПЕХ И АРЕАЛЫ А.Н. Милишников Институт проблем экологии и эволюции им. А.Н. Северцова РАН, г. Москва milishnikov@mail.ru В сравнительном анализе био...»

«Министерство образования Российской Федерации Ярославский государственный университет им. П.Г. Демидова Кафедра экологии и зоологии Общая экология Методические указания к семинарским занятиям Ярославль 2002 ББК Е9я73 Т99 Составитель: проф. Н.Н. Тятенкова Основы физи...»

«УДК 615.074, 615.072 РАЗРАБОТКА МЕТОДИКИ СТАНДАРТИЗАЦИИ ТРАВЫ РЕПЕШКА ОБЫКНОВЕННОГО AGRIMONIA EUPATORIA ПО ФЛАВОНОИДАМ Ж.С. Лесовая Надземная часть репешка обыкновенного используется в народной медицине при лечении многих заболеваний, в частности, Д.И. Писарев заболеваний печени и же...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ ВОРОНЕЖСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ ПРОГРАММА Курса: ГЕОЛОГИЯ МЕСТОРОЖДЕНИЙ ПОЛЕЗНЫХ ИСКОПАЕМЫХ Специальность 013300 – экологическая геология ОПД....»

«MИРЗАЛИ МУРГУЗОВ, РАСИМ АБДУРАЗАГОВ РОВШАН АЛИЕВ, ДИЛБАР АЛИЕВА, ГАБИЛЬ БАЙРАМЛЫ ФИЗИКА 9 МЕТОДИЧЕСКОЕ ПОСОБИЕ ДЛЯ УЧИТЕЛЯ по предмету “Физика” для 9-го класса общеобразовательных школ. Утвержден Министерством образования Азербайджанской Рес...»

«Активизация познавательной деятельности учащихся на уроках биологии". Введение Вопросы активизации учения школьников относятся к числу наиболее актуальных проблем современной педагогической науки и прак...»




 
2019 www.mash.dobrota.biz - «Бесплатная электронная библиотека - онлайн публикации»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.