WWW.MASH.DOBROTA.BIZ
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - онлайн публикации
 

«Особенности распределения штамма мезенхимальных стволовых клеток в условиях опухолевого роста после сингенной трансплантации мышам линии C57BL/6 03.01.06 – биотехнология (в том числе ...»

ФЕДЕРАЛЬНАЯ СЛУЖБА ПО НАДЗОРУ В СФЕРЕ ЗАЩИТЫ ПРАВ

ПОТРЕБИТЕЛЕЙ И БЛАГОПОЛУЧИЯ ЧЕЛОВЕКА

ФЕДЕРАЛЬНОЕ БЮДЖЕТНОЕ УЧРЕЖДЕНИЕ НАУКИ

ГОСУДАРСТВЕННЫЙ НАУЧНЫЙ ЦЕНТР

ВИРУСОЛОГИИ И БИОТЕХНОЛОГИИ «ВЕКТОР»

На правах рукописи

ТРИФОНОВА

Кристина Эдуардовна Особенности распределения штамма мезенхимальных стволовых клеток в условиях опухолевого роста после сингенной трансплантации мышам линии C57BL/6 03.01.06 – биотехнология (в том числе бионанотехнологии)

ДИССЕРТАЦИЯ

на соискание ученой степени кандидата биологических наук

Научные руководители:

кандидат медицинских наук, Нечаева Елена Августовна доктор медицинских наук Повещенко Александр Федорович Кольцово

ОГЛАВЛЕНИЕ

ВВЕДЕНИЕ………………………………………………………………... 5 ГЛАВА I. ОБЗОР ЛИТЕРАТУРЫ……………………………………… 9

1.1. Свойства и функции мезенхимальных стволовых клеток костного мозга………………………………………………………………………… 9

1.2. Миграционная активность МСК……………………………………... 10

1.3. Методы противоопухолевой терапии с применением МСК……….. 12 1.3.1. Таргетная доставка цитокинов с помощью МСК………….. 14 1.3.2. Доставка пролекарств с помощью МСК…………………… 15 1.3.3. Применение МСК для доставки онколитических вирусов…. 15 1.3.4. МСК – доставщики антиангиогенных веществ……………. 16 1.3.5. Адресная доставка проапоптотических белков с помощью МСК…………………………



1.3.6. Применение немодифицированных МСК для терапии рака... 17

1.4. Распределение МСК после трансплантации………………………… 18 1.4.1. Способы визуализации МСК в организме реципиента после трансплантации

1.5. Современное представление о влиянии МСК на опухолевый рост... 23 Принципы регуляции опухолевого процесса 1.5.1 .

мезенхимальными стволовыми клетками…………………..………. 26 Заключение…………………………………………………………………. 31 ГЛАВА II. МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ……….. 33

2.1. Выделение МСК из костного мозга мышей…………………………. 33

2.2. Культивирование МСК костного мозга……………………………… 33

2.3. Культивирование клеток В16-F10……………………………….…. .

2.4. Индукция адипогенной дифференцировки МСК…………………… 35

2.5. Индукция остеогенной дифференцировки МСК……………………. 35

2.6. Иммунофенотипирование МСК……………………………………… 36

2.7. Исследование миграционной активностиМСК к опухолевым клеткам с помощью двухкамерной культуральной системы…………

2.8. Оценка жизнеспособности опухолевых клеток с помощью МТТтеста…………………………………………………………………………. 36

2.9. Прижизненная окраска МСК красителем Хехст 33342…………….. 37

2.10. Схема эксперимента изучения распределения МСК в организме здоровых мышей и мышей-опухоленосителей…………………………... 37 Анализ выживаемости животных и изменения объема 2.11 .

опухолей……………………………………………………………………. 38

2.12. Выделение ДНК……………………………………………………… 38

2.13. Количественная полимеразная цепная реакция в режиме реального времени…………………………………………………………. 39

2.14. Приготовление срезов на замораживающем микротоме………….. 40

2.15. Статистическая обработка полученных результатов……………… 41 ГЛАВА III. РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЙ……………………… 42

3.1. Получение и морфофункциональная характеристика штамма мезенхимальных стволовых клеток костного мозга мышей линии C57BL/6…………………………………………………………...….……… 42



3.2. Изучение миграционной активности МСК в условиях опухолевого роста и влияния МСК на пролиферацию клеток линии В16-F10 в системе in vitro ……………………………...…………………………...… 47

3.3. Влияние внутривенной трансплантации МСК на выживаемость животных-опухоленосителей и кинетику роста меланомы В16-F10...… 50

3.4. Количественное распределение трансплантированных МСК…… 51 3.4.1. Распределение МСК в организме здоровых животных и животных – носителей меланомы В16-F10 через 1 час после трансплантации ………………………………………………………. 53 3.4.2. Распределение МСК в организме здоровых животных и животных – носителей меланомы В16-F10 через 3 суток после трансплантации ………………………………………………….…… 54 3.4.3. Распределение МСК в организме здоровых животных и животных – носителей меланомы В16-F10 через 7 суток после трансплантации …………………………… 3.4.4. Распределение МСК в организме здоровых животных и животных – носителей меланомы В16-F10 через 14 суток после трансплантации……………………………………………………….. 58 3.4.5. Кинетика накопления МСК в различных органах здоровых животных и животных-носителей опухоли в течение 14 суток…… 60

3.5. Исследование распределения МСК в организме животных – носителей меланомы В16-F10 при помощи флуоресцентной микроскопии………………………………………………………………... 63

ГЛАВА IV. ОБСУЖДЕНИЕ РЕЗУЛЬТАТОВ ИССЛЕДОВАНИЯ... 70

ЗАКЛЮЧЕНИЕ…………………………………………………………… 83 ВЫВОДЫ………………………………………………………………….. 86 СПИОК СОКРАЩЕНИЙ………………………………………………... 88 СПИСОК ИСПОЛЬЗУЕМОЙ ЛИТЕРАТУРЫ……………………… 90

ВВЕДЕНИЕ

Актуальность исследования Развитие современной биотехнологии во многом связано с использованием культивируемых клеток различного in vitro происхождения. В последние годы растет число публикаций, посвященных применению клеточных технологий для противоопухолевой терапии .

Большинство этих сообщений посвящено применению мезенхимальных стволовых клеток (МСК) для адресной доставки различных терапевтических агентов в область опухолевого очага, что позволяет значительно минимизировать токсическое воздействие препарата на здоровые ткани [1, 2, 3, 4] .

Применение мезенхимальных стволовых клеток для доставки противоопухолевых препаратов основано на гипотезе о том, что в условиях канцерогенеза стволовые клетки мигрируют преимущественно в опухолевую ткань. Тропизм МСК к злокачественным образованиям впервые был продемонстрирован в работе М. Studeny, в которой авторы применили МСК для доставки интерферона бета в область локализации опухолевого очага [4]. В последующих работах МСК были использованы для доставки к опухолям различных терапевтических агентов, например, цитокинов [5], пролекарств [6], онколитических вирусов [7, 8], антиангиогенных веществ [9] и других .

Однако свойство МСК мигрировать в очаг новообразования не является абсолютно доказанным и требует дополнительного экспериментального подтверждения .



Поскольку на сегодняшний день все больше появляется данных о том, что трансплантированные МСК обнаруживаются не только в опухолевой ткани, но и в других тканях, таких как, печень, селезенка, головной мозг [10, 11, 12]. Возможно, причины такого расхождения экспериментальных данных связаны с применением различных методов детектирования МСК после трансплантации (флуоресцентные и биолюминесцентные способы визуализации, различные виды томографии, ПЦР, флуоресцентная микроскопия и другие), которые обладают различной степенью чувствительности и специфичности .

Кроме того, на распределение МСК после трансплантации влияет множество других факторов, таких, как способ введения клеток, ксеногенная или сингенная трансплантация МСК и опухоли, источник мезенхимальных стволовых клеток (костный мозг, жировая ткань, пуповинная кровь и другие), тип опухолевых клеток, срок проведения исследования после трансплантации клеток (1 час, сутки, месяцы) .

Таким образом, учитывая расхождение экспериментальных данных, применение различных методов визуализации трансплантированных МСК, различных экспериментальных моделей, установление особенностей распределения МСК после внутривенной трансплантации в условиях канцерогенеза является актуальной задачей .

Цели и задачи Целью данного исследования является установление особенностей распределения МСК после внутривенной трансплантации в условиях опухолевого роста на модели меланомы В16-F10 .

Для достижения указанной цели были поставлены следующие задачи:

Получение и морфофункциональная характеристика штамма 1 .

мезенхимальных стволовых клеток костного мозга мышей линии C57BL/6 .

Изучение миграционной активности МСК в условиях 2 .

опухолевого роста и влияния МСК на пролиферацию клеток линии В16F10 в системе in vitro .

Оценка влияния внутривенного введения МСК на 3 .

выживаемость животных – опухоленосителей и рост меланомы В16-F10 .

Изучение распределения МСК после внутривенного введения в 4 .

организме интактных мышей и при наличии опухолевого процесса методом ПЦР в режиме реального времени .

Исследование распределения МСК в организме животных – 5 .

носителей меланомы В16 при помощи флуоресцентной микроскопии .

Научная новизна Впервые получен штамм мезенхимальных стволовых клеток костного мозга мышей линии C57BL/6, который обладает стабильными свойствами, безопасен и перспективен для проведения фундаментальных научных исследований и доклинической оценки мезенхимальных стволовых клеток в качестве средства доставки противоопухолевых препаратов .

Впервые продемонстрированы различия в распределении мезенхимальных стволовых клеток после внутривенной трансплантации в организме интактных мышей и мышей с привитой меланомой В16-F10 .

Практическая значимость Получен и заложен на хранение в коллекцию культур клеток ФБУН ГНЦ ВБ «Вектор» штамм мезенхимальных стволовых клеток костного мозга мышей линии C57BL/6. Штамм охарактеризован в соответствии с требованиями к диплоидным и перевиваемым культурам клеток .

Разработана стандартная операционная процедура «Выделение мезенхимальных стволовых клеток костного мозга мышей линии C57BL/6», которая внедрена в работу отдела клеточных технологий ФБУН ГНЦ ВБ «Вектор» .

Результаты диссертационной работы внедрены в учебный процесс кафедры анатомии, физиологии и безопасности жизнедеятельности ФГБОУ ВПО Новосибирского государственного педагогического университета (Новосибирск) .

Положения, выносимые на защиту Стабильность характеристик штамма мезенхимальных 1 .

стволовых клеток костного мозга мышей линии C57BL/6 позволяет использовать его для проведения фундаментальных научных исследований и доклинической оценки МСК в качестве средства доставки противоопухолевых препаратов .

Особенности распределения мезенхимальных стволовых 2 .

клеток после системного введения зависят от наличия и стадии опухолевого роста .

На поздних стадиях канцерогенеза миграция мезенхимальных 3 .

стволовых клеток изменятся с направленностью преимущественно в костный мозг .

Апробация работы. По результатам работы опубликовано 3 статьи, из них 2 в журналах из списка научных журналов, рекомендуемых ВАК Минобрнауки России, также материалы работы представлены на всероссийских и международных конференциях, по итогам которых опубликовано 7 тезисов .

Личный вклад. Экспериментальные исследования, представленные в диссертации, проводились либо лично автором, либо при непосредственном участии автора. Автор принимал активное участие в обработке экспериментальных данных, обсуждении и опубликовании результатов .

Благодарности. Автор приносит благодарность своим коллегам, в тесном сотрудничестве с которыми была выполнена диссертационная работа, а именно: Соловьевой А.О., Воронцовой Е.А., Радаевой И.Ф., Орешковой С.Ф., Авророву П., Думченко Н.Б., Максютову Р.А., Трегубчак Т.В. Особую благодарность автор выражает научным руководителям Нечаевой Елене Августовне и Повещенко Александру Федоровичу за помощь на всех этапах выполнения диссертационной работы .

ГЛАВА I. ОБЗОР ЛИТЕРАТУРЫ

1.1. Свойства и функции мезенхимальных стволовых клеток костного мозга Среди негемопоэтических клеток, используемых для клеточной терапии, наибольший интерес для исследователей представляют мезенхимальные стволовые клетки, выделенные из костного мозга .

Основоположником учения о МСК считается А.Я. Фриденштейн, который в начале 70-х гг. прошлого века открыл популяцию костномозговых негемопоэтических клеток, которые в культуре ткани формировали так называемые колониеобразующие единицы фибробластов [13]. Позднее с учетом способности этих клеток к самоподдержанию и дифференцировке в различные клеточные линии мезенхимы, Каплан А.И .

ввел термин «мезенхимальные стволовые клетки» [14]. Сравнительно недавно международным обществом клеточной терапии был введен термин «мультипотентные мезенхимальные стромальные клетки – multipotent mesenchymal stromal cells (MMSC)» [15] .

К общим свойствам МСК костного мозга относят: способность к симметричному и асимметричному делению, высокий пролиферативный потенциал, высокую способность к адгезии, фибробластоподобную морфологию, легко индуцируемую дифференцировку. МСК широко исследуются для терапии различных заболеваний и травматических повреждений [16, 17, 18, 19, 20] .

Первоначально МСК изучались в связи с их ведущей ролью в формировании гематопоэтического микроокружения [13]. Впоследствии этот тип клеток оказался в центре внимания в связи с выявлением у них неожиданного дифференцировочного потенциала. Так, было показано, что МСК костного мозга способны дифференцироваться в остеобласты, хондроциты, фибробласты, адипоциты миобласты, [21, 22], кардиомиоцитоподобные клетки [23] и нейроны [24] .

На сегодняшний день установлено, что МСК должны экспрессировать следующие маркеры: CD105, CD73, CD90 и не должны экспрессировать CD34, CD45, CD14 или CD11b, CD79 или CD19 и HLADR [25]. МСК формируют достаточно динамичную систему в костном мозге, состоящую из дифференцированных фибробластов, ретикулярных клеток, эндотелия, компонентов экстрацеллюлярного матрикса, цитокинов [25] .

В многочисленных исследованиях также было показано, что МСК обладают уникальными иммуномодулирующими свойствами. Они способны ингибировать пролиферацию активированных лимфоцитов, снижать продукцию провоспалительных цитокинов, подавляя, таким образом, воспалительный процесс [26]. Иммуносупрессивные свойства этих клеток применяют в клинической практике для подавления реакций трансплантат против хозяина при пересадке костного мозга и терапии некоторых аутоиммунных заболеваний [27, 28] .

При повреждении тканей и органов МСК способны дифференцироваться в тканевые элементы, поддерживать образование новых сосудов, синтезировать цитокины и факторы роста, тем самым стимулируя регенерацию и восстановление поврежденной ткани .

Восстановительный потенциал МСК установлен при многих нозологических формах, включая такие заболевания, как диабет, инсульт и паркинсонизм [29] .

Многими авторами установлено, что трансплантированные МСК имеют тропизм к опухолям, то есть они способны мигрировать из непораженной области в опухоль. Единого представления о биологической значимости этого процесса нет, однако показано участие мигрирующих МСК в формировании стромы опухолей [30, 31] .

1.2. Миграционная активность МСК Миграционная способность мезенхимальных стволовых клеток к опухоли обусловлена биохимическими сигналами, распознаваемыми системой рецепции клетки и способностью клеток к хемотаксису. Этот процесс протекает с участием сигнальных молекул и заканчивается «заякориванием» клетки в своей нише .

Молекулярные основы тропизма МСК к опухоли еще плохо изучены, но уже показано, что хемотаксис стволовых клеток зависит от различных рецептор – лигадных миграционных осей: CXCR4/SDF-1 [32], c-Met/ HGF [33], VEGFR/VEGF [34], CCR2/ MCP-1 [35] и uPAR/ uPA [36] .

В настоящее время самым изученным фактором миграции МСК к опухоли является рецептор – лигандная ось CXCR4/SDF-1. МСК костного мозга экспрессируют на своей мембране рецептор CXCR4, связывающийся со специфическим лигандом – молекулой SDF-1 (stromal derived factor), который продуцируется опухолевыми клетками [37]. В ответ на рост концентрации SDF-1, который вырабатывается опухолевыми клетками, стволовые клетки способны выходить из своих ниш, проникать в кровяное русло и мигрировать на большие расстояния в область новообразования .

Фактор роста гепатоцитов (HGF) – гликопротеин, обладающий сильной митогенной активностью в отношении неопластических клеток .

Действие лиганда реализуется через рецептор мезенхимальных стволовых клеток c-Met [38]. Взаимодействие оси c-Met/ HGF снижает степень адгезии клеток, увеличивает их мобильность, индуцирует синтез многочисленных ферментов деградации межклеточного матрикса и индуцирует процессы миграции [39]. Очевидно, биологическим смыслом этого явления является скорейшее прибытие стволовых клеток в область повреждения для биоинформационной оценки ситуации и запуска процессов пролиферации или апоптоза .

VEGF (vascular endothelial growth factor) является одним из самых мощных индукторов ангиогенеза и клеточной миграции. Роль VEGFR/VEGF рецептор – лигандной оси в качестве одного из механизмов направленной миграции и хоуминга стволовых клеток показана в эксперименте на модели опухолевых заболеваний мозга. Показано, что рецептор VEGFR2 преимущественно экспрессируется на поверхности CD133-позитивных опухолевых стволовых клеток глиомы человека .

Блокирование рецептора VEGFR2 приводило к ингибированию сигнального пути VEGF-VEGFR2- Нейропилин-1, который опосредует туморогенность и способность опухолевых клеток глиомы к самообновлению [40] .

Значение CCR2/MCP-1 оси в процессах направленной миграции и хоуминга стволовых клеток было открыто сравнительно недавно. В норме, лиганд в организме MCP-1 (Monocyte chemoattractant protein-1) млекопитающих и человека стимулирует хемотаксис моноцитов к области повреждения и является одним из профакторов воспалительной реакции [35]. Источником MCP-1 являются поврежденные астроциты, нейроны, микроглиальные элементы и опухолевые клетки. Взаимодействие MCP-1 с рецептором CCR2 клеточной поверхности МСК иммобилизует их из эндоваскулярных ниш, индуцирует активную миграцию МСК в область новообразования, модулирует процессы пролиферации и дифференцировки [41, 42] .

Активатор урокиназы плазминогена (uPA) и его рецептор регулируют процессы прикрепления клеток, миграцию, пролиферацию и дифференцировку. Активация uPAR/uPA оси стимулирует направленную миграцию в ишемический или неопластический очаг [43] .

Таким образом, выраженный тропизм МСК в зону новообразования представляет собой многоуровневый регуляторный механизм поддержания тканевого гомеостаза. Изучение роли процессов направленной миграции и хоуминга МСК к опухолевому очагу позволило использовать их как транспортных посредников для адресной доставки различных противоопухолевых агентов в очаг новообразования .

1.3. Методы противоопухолевой терапии с применением МСК Способность мезенхимальных стволовых клеток мигрировать в область новообразования, преодолевая при этом значительные расстояния от точки введения, стала основой для разработки ряда принципиально новых технологий адресной доставки терапевтических агентов непосредственно в опухолевую ткань .

Клеточная терапия опухолевых новобразований с применением МСК включает несколько этапов: 1) генная модификация мезенхимальных стволовых клеток терапевтическими агентами; 2) трансплантация модифицированных МСК в организм реципиента и последующая миграция стволовых клеток к опухолевому очагу; 3) энграфтинг мезенхимальных стволовых клеток в опухоль и экспрессия противоопухолевых агентов; 4) гибель раковых клеток (рис. 1) .

Адресная доставка фармакологических препаратов МСК непосредственно к месту действия позволила снизить токсичность химиотерапии и воздействовать на гипоксические зоны опухоли. Помимо транспорта химиотерапевтических препаратов, особо перспективными представляются методы высокоточной доставки в опухолевые клетки терапевтических генов, цитокинов, пролекарств, онколитических вирусов и других противоопухолевых агентов .

Рис.1 Диагностика и терапия рака с помощью трансплантированных модифицированных мезенхимальных стволовых клеток .

(а) Химическая модификация путем биотин-стрептавидин конъюгации либо ферментативной модификации для связывания с несколькими лигандами (желтый и зеленый) на поверхности МСК .

(б) Генно-инженерная модификация МСК для экспрессии противоопухолевых агентов (интерферона бета, интерлейкинов, пролекарств и т.д.) .

(в) Противоопухолевые агенты (маленькие оранжевые кружки) могут быть инкапсулированы в наночастицы (большие красные круги) (г) Высвобождение противоопухолевых агентов и гибель раковых клеток (д) Диагностика опухолевых заболеваний, основанная на конъюгации опухолевых белков и рецепторов МСК, связанных с флуоресцентно мечеными аптамерами .

1.3.1. Таргетная доставка цитокинов с помощью МСК Интерлейкины (IL) – это цитокины, которые регулируют воспалительные и иммунные реакции и, как известно, обладают либо прямым противоопухолевым эффектом, либо опосредованным модуляцией иммунной системы .

Показано, что введение гена интерлейкина-12 мезенхимальным стволовым клеткам предотвращает метастазирование меланомы в лимфатические узлы и другие внутренние органы, а также вызывает апоптоз опухолевых клеток на моделях меланомы, рака молочной железы и гепатомы [44]. Трансплантация МСК, секретирующих IL-18, вызывала усиление T клеточной инфильтрации и развитие долгосрочного противоопухолевого иммунитета у мышей с неинвазивными и инвазивными глиомами [45]. Кроме перечисленных видов интерлейкинов в различных исследованиях стволовые клетки трансформировались для секреции IL-2 [8] и IL-7 [2] .

Установлено, что интерферон бета оказывает (IFN-) проапоптотический и антипролиферативный эффект на опухолевые клетки [46, 47]. Однако применение интерферона бета in vivo ограничено из-за его высокой токсичности при системном введении. Для решения этой проблемы мезенхимальные стволовые клетки были модифицированы с целью адресной доставки IFN- к метастатическому раку молочной железы и меланоме [4], глиоме [48], метастазам в легких [49] .

Недавние исследования показали противоопухолевый эффект интерферона альфа который доставляли с помощью (IFN-), мезенхимальных стволовых клеток. IFN- часто используется в качестве терапевтического адъюванта для предупреждения микрометастазирования у пациентов с высоким риском рецидивов [50]. Системное введение МСК, секретирующих IFN-, вызвало ингибирование роста меланомы и значительно продливало продолжительность жизни животных путем усиления апоптоза опухолевых клеток и ингибирования формирования сосудистой сети опухоли [51] .

1.3.2. Доставка пролекарств с помощью МСК Пролекарство – вещество, которое представляет собой молекулярную модификацию активного лекарственного препарата. Такая модификация генерирует образование нового соединения, способного метаболически или химически превращаться в организме в действующее лекарственное вещество .

Принцип лечения пролекарствами заключается в превращении в строме опухоли системно введенных нетоксичных пролекарств в токсичные антиметаболиты. Такой подход изначально изучали с применением цитозин деаминазы (CD), которая может превращать нетоксичное пролекарство 5-фторцитозин в 5-фторурацил. Этот химиотерапевтический агент может легко диффундировать из мезенхимальных стволовых клеток в окружающие ткани и селективно поражать быстро делящиеся клетки [52] .

МСК, модифицированные для секреции тимидинкиназы вируса простого герпеса, показывали высокую терапевтическую эффективность, вызывая значительное сокращение объемов опухоли [1] .

1.3.3. Применение МСК для доставки онколитических вирусов Онколитические вирусы – это естественные или генетически модифицированные вирусы, которые, после инфекции, избирательно реплицируются и поражают опухолевые клетки, не затрагивая здоровые клетки [53, 54] .

Системное введение онколитических вирусов зачастую является неэффективным из-за уничтожения вирусов защитными механизмами хозяина и миграции в здоровые ткани через кровоток [55] .

Доставка онколитических вирусов с помощью мезенхимальных стволовых клеток может защитить вирусы от элиминации иммунной системой хозяина. МСК используются в качестве клеток-хозяев для репликации, транспортировки и локальной условно интактной репликации онколитических аденовирусов [56]. МСК человека были использованы для репликации тимидинкиназы аденовируса и оказывали противоопухолевый эффект на различных линиях раковых клеток [57] .



Внутривенное введение МСК, несущих аденовирус, на мышиной модели рака яичников, привело к значительному противоопухолевому эффекту и увеличению выживаемости животных по сравнению с прямым введением вируса [58] .

1.3.4. МСК – доставщики антиангиогенных веществ Результатами опухолевого ангиогенеза являются бурная прогрессия опухоли, возрастание ее инвазивности и метастатической активности [59] .

Данные о различных факторах роста и молекулах внеклеточного матрикса, ответственных за опухоль-опосредованный ангиогенез, дают возможность использовать целевую антиангиогенную терапию [60] .

В клинических испытаниях фазы II были получены доказательства того, что доставка антиангиогенных лекарств через сосудистую сеть временно нормализует аномальные структуры и функции кровеносных сосудов и приводит к уменьшению опухоли, связанному с вазогенным отеком мозга, и к клиническим преимуществам у большинства пациентов [9] .

Как известно, после внутриопухолевой трансплантации МСК эти клетки локализуются в сосудистой сети опухоли, что дает возможность применять мезенхимальные стволовые клетки для таргетной терапии васкуляризованных новообразований [61, 62]. В недавних исследованиях группа авторов показала, что однократное введение МСК для доставки антиангиогенного фактора тромбоспондина [TSP] -1 заметно уменьшает плотность сосудов опухоли, что в результате ингибирует рост опухоли и увеличивает выживаемость мышей с привитой глиомой человека [3] .

1.3.5. Адресная доставка проапоптотических белков с помощью МСК Доставка проапоптотических белков, таких как TRAIL (цитокин семейства факторов некроза опухоли, лиганд, вызывающий апоптоз) с помощью мезенхимальных стволовых клеток является относительно новым подходом противоопухолевой терапии .

TRAIL является эндогенным членом семейства лигандов ФНО, который связывается с доменом убийства, содержащим рецепторы DR4 и и индуцирует апоптоз посредством активации каспазы DR5, преимущественно в раковых клетках, не влияя на большинство других типов клеток [63] .

Ряд исследований показали высокую терапевтическую эффективность различных типов стволовых клеток, включая мезенхимальные стволовые клетки, модифицированных для экспрессии TRAIL, в мышиных моделях колоректального рака [64], глиомы [65, 66], рака легких, молочной железы, плоскоклеточного рака и рака шейки матки [67] .

1.3.6. Применение немодифицированных МСК для терапии рака Помимо применения МСК для доставки различных противоопухолевых агентов немодифицированные мезенхимальные стволовые клетки используют для клеточной терапии онкологических заболеваний. Противоопухолевый эффект данного типа клеток показан на различных экспериментальных моделях in vitro и in vivo. Этот эффект связан с факторами, выделяемыми мезенхимальными стволовыми клетками, которые ингибируют пролиферацию клеток глиомы, меланомы, рака легкого, гепатомы, рака молочной железы [68, 48, 69, 70] .

Установлено, что МСК человека, внутривенно введенные мышам – носителям саркомы Капоши, мигрировали в область развития опухоли и эффективно ингибировали опухолевый рост [71]. Также показано, что МСК оказывают антиангиогенный эффект на модели in vitro, а также в испытаниях на модели мышиной меланомы. Введение МСК мышам с привитой меланомой индуцировало апоптоз опухолевых клеток и тормозило рост опухоли [72] .

Таким образом, МСК имеют огромный потенциал для применения в противоопухолевой терапии, но на сегодняшний день единого представления о влиянии МСК на опухолевый рост и распределении этих клеток после трансплантации нет. Данные о распределении МСК после трансплантации в организме реципиента в условиях опухолевого роста имеют важное значение для понимания механизмов хоуминга, участия МСК в канцерогенезе и разработки оптимальных протоколов лечения стволовыми клетками .

1.4. Распределение МСК после трансплантации Исследования распределения мезенхимальных стволовых клеток после трансплантации необходимы не только для анализа эффективности клеточной терапии различных заболеваний, но и для оценки возможных рисков причинения вреда здоровью человека. На сегодняшний день получено множество данных о распределении МСК после введения на различных экспериментальных моделях .

Среди способов введения клеточного материала в организм наиболее актуальна в настоящее время внутривенная трансплантация мезенхимальных стволовых клеток с последующей задержкой клеток в кровеносных сосудах легких либо миграцией в печень и селезенку реципиента [73]. Помимо внутривенного введения, среди способов трансплантации МСК животным-опухоленосителям можно выделить следующие: интратрахеальное внутриартериальное [74], [48], внутрибрюшинное [58] и подкожное [75]. Показано отсутствие накопления МСК в очаге опухолевого роста в головном мозге при внутривенной трансплантации и детектирование МСК в глиоме при внутриопухолевом введении клеточного материала [61] .

Критическим фактором, определяющим распределение клеток после трансплантации, является выбор экспериментальной модели in vivo:

сингенная или ксеногенная трансплантация МСК и опухоли. Показано, что при внутривенном введении сингенных мезенхимальных стволовых клеток костного мозга мышам линии BALB/c – носителям мышиной карциномы почек, клетки донорского происхождения были обнаружены как в опухолевой ткани, так и в здоровых тканях: печени, селезенке и легких Выбирая ксеногенную модель, исследователи используют [10] .

иммунодефицитных мышей NOD или SCID, которым прививают опухоль человека и вводят мезенхимальные стволовые клетки человека. Так, например, при внутривенном введении МСК человека иммунодефицитным мышам – носителям рака молочной железы человека MDA 231, либо меланомы человека A375SM большинство трансплантированных клеток авторы детектировали в опухолевых тканях и единичные клетки в – печени, в остальных исследованных органах и тканях: почках, селезенке, мышцах МСК не обнаружены [5] .

Кроме того, в различных экспериментальных моделях исследователи используют различные источники мезенхимальных стволовых клеток. Так, группа авторов исследовала распределение после трансплантации МСК, выделенных из двух самых популярных источников: костного мозга и жировой ткани. Через 7 дней и 91 день после трансплантации МСК жировой ткани детектировали в ткани легких, тогда как клетки, выделенные из костного мозга, в легких не были обнаружены [76] .

Другим не менее важным аспектом исследований распределения МСК является срок после трансплантации клеток. Было показано, что в первые часы после внутривенной трансплантации интактным мышам мезенхимальные стволовые клетки в основном обнаруживали в легких .

После чего клетки рециркулировали, и через 48-96 часов после введения МСК детектировали в печени, селезенке, поджелудочной железе, головном мозге, почках, сердце и костном мозге [77]. При изучении распределения МСК костного мозга в течение длительного времени (7 дней и 3 месяца) трансплантированный клеточный материал был найден только через 7 дней в селезенке [76]. В более долгосрочных экспериментах от 4 до 13 месяцев после внутривенного введения МСК интактным мышам показано присутствие трансплантированных клеток в костной и хрящевой ткани, костном мозге, селезенке и мышцах [78] .

Таким образом, можно сделать вывод, что на распределение клеток после трансплантации оказывает влияние множество факторов, таких как способ введения клеток, экспериментальная модель, источник мезенхимальных стволовых клеток (костный мозг, жировая ткань, пуповинная кровь и другие), срок проведения исследования после трансплантации клеток (1 час, сутки, месяцы). Систематический анализ этих и других факторов позволит разработать безопасные протоколы лечения различных заболеваний стволовыми клетками .

1.4.1. Способы визуализации МСК в организме реципиента после трансплантации Методы изучения участия мезенхимальных стволовых клеток в онкогенезе и визуализации клеток в организме реципиента после трансплантации можно разделить на две большие группы: прижизненные и поствитальные .

Персонифицированное лечение с использованием аутологичных и аллогенных МСК уже на сегодняшний день является реальностью, поэтому возрастает потребность в неинвазивных прижизненных методах визуализации. Прижизненные способы биовизуализации делят на оптические (флуоресцентные и биолюминесцентные способы визуализации) и неоптические (различные виды томографии) .

Неоптические методы визуализации, такие как магнитнорезонансная томография, однофотонная эмиссионная компьютерная томография, позитронно-эмиссионная томография широко применяются в клинической практике для исследования распределения клеток после трансплантации в организме человека .

Магнитно-резонансная томография (МРТ) – это неинвазивный способ визуализации, основанный на измерении электромагнитного отклика ядер атомов водорода. В настоящее время МРТ – высокоточный, чувствительный, специфичный метод диагностики злокачественных новообразований человека [79]. Магнитно-резонансная визуализация была использована для детекции МСК, меченных магнитными наночастицами, в организме иммунодефицитных мышей – носителей глиомы [80] .

Позитронно-эмиссионная томография (ПЭТ) – это радионуклидный томографический метод исследования, основанный на детекции позитронизлучающих радиоизотопов. ПЭТ применяется для диагностики опухолей человека, а также для детекции терапевтических цитолитических Т-клеток, меченных геном-репортером [81]. Экспрессия гена-репортера HSV1-tk или HSV1-sr39tk при взаимодействии с субстратом 18F-FHBG, детектировалась с помощью ПЭТ для визуализации миграции МСК к глиобластоме [82] .

Однофотонная эмиссионная компьютерная томография (ОФЭКТ) – это диагностический метод создания томографических изображений с использованием главным образом агентов с гамма-излучающими радиоизотопами. ОФЭКТ в сочетании с ПЭТ и компьютерной томографией была успешно использована для визуализации меченных лейкоцитов, мезенхимальных стволовых клеток, прогениторных клеток в организме мышей, крыс, свиней [83, 84, 85, 86, 87]. Однако клиническое применение ОФЭКТ для визуализации клеток в настоящее время остается под вопросом из-за недостатка информации о влиянии радиоизотопов на функциональную активность клеток .

Совершенствуются методы изучения миграции клеток, основанные на метках гена-репортера, биолюминесценции и флуоресценции – методы оптической визуализации. Большинство методов оптической визуализации основаны на экзогенном введении флуорофора (или его предшественника) в организм (клетку) и обнаружении флуоресценции маркированных объектов в естественном окружении. В качестве флуорофоров используют флуоресцентные белки, наночастицы, квантовые точки, флуоресцентные красители, зонды и антитела [88] .

К поствитальным способам визуализации можно отнести гистологические методы, флуоресцентную гибридизацию, in situ полимеразную цепную реакцию, иммуногистохимию, проточную цитометрию. Главным недостатком поствитальных способов визуализации является невозможность их применения в клинической практике. Однако благодаря этим методам стало возможным изучение энграфтинга мезенхимальных стволовых клеток в опухоль, а также исследование морфологии, дифференцировки и функций стволовых клеток в канцерогенезе. Гистологические методы позволяют детектировать МСК благодаря использованию зеленого флуоресцентного белка (GFP) [89], антител к люцифиразе [90], античеловеческих антител [91]. С помощью гистологических методов стала возможной идентификация дифференцировки мезенхимальных стволовых клеток в перициты [92], эндотелиальные клетки, адипоциты, остеобласты [92, 48, 73]. Проточная цитометрия и полимеразная цепная реакция в режиме реального времени позволяет определить количество трансплантированных МСК в опухоли и здоровых тканях реципиента [93, 94, 95]. Флуоресцентная in situ гибридизация была использована для детекции y-хромосомы мезенхимальных стволовых клеток самца, трансплантированных самкам – носителям глиомы [61] .

Таким образом, на данный момент существует значительное разнообразие систем детекции и контрастирующих агентов трансплантированных клеток в организме реципиента. Биовизуализация МСК с применением высокоточных современных методов детекции имеет особенно важное значение для развития понимания роли МСК в канцерогенезе и разработки новых подходов противораковой терапии с использованием стволовых клеток .

1.5. Современное представление о влиянии МСК на опухолевый рост Клиническое применение мезенхимальных стволовых клеток в противоопухолевой терапии в качестве доставщиков различных противораковых агентов либо в виде самостоятельного препарата на сегодняшний день ограничено из-за отсутствия единого представления о влиянии МСК на опухолевый процесс .

Необходимо подчеркнуть противоречивость имеющихся экспериментальных данных: согласно одним исследованиям МСК стимулируют рост опухоли [96, 97], согласно другим, наоборот, МСК угнетают опухолевый рост [98, 99]. Кроме того, в литературе встречаются сообщения, свидетельствующие о том, что МСК не ингибируют и не стимулируют процесс неопластического роста [5, 11]. На пути к клиническому применению МСК для лечения онкологических больных необходимо выяснить причины такого расхождения научных фактов и установить механизмы взаимодействия опухолевых и стволовых клеток .

Многочисленные исследования продемонстрировали, что МСК направленно мигрируют к неопластическому очагу. После достижения очага новообразования мезенхимальные стволовые клетки способны встраиваться в сосудистую сеть и некротические области опухоли. Далее

МСК дифференцируются в различные компоненты опухолевой стромы:

фибробласты, периэндотелиальные клетки, адипоциты, остеобласты и многие другие. Подобно формированию микроокружения гемопоэтических клеток в костном мозге, МСК способны формировать нишу для поддержки опухолевых стволовых клеток в опухолевой ткани .

Такая поддержка формирования фиброваскулярной стромы и паренхимы опухоли мезенхимальными стволовыми клетками может значительно стимулировать неопластический рост [100] .

Большое количество сообщений свидетельствует об индукции мезенхимальными стволовыми клетками опухолевого роста и метастазирования. Показано, что МСК костного мозга могут дифференцироваться в опухолевые миофибробласты и стимулировать рост карциномы желудка [101]. Кроме того, отмечено, что МСК способны дифференцироваться в опухолевые перициты и секретировать проангиогенные факторы, индуцируя неопластический ангиогенез [102, 103]. МСК, подкожно введенные мышам – носителям рака молочной железы, усиливали подвижность, экстравазацию и интравазацию опухолевых клеток, тем самым стимулируя метастазирование опухоли [89]. Продемонстрировано участие мезенхимальных стволовых клеток в формировании костномозговых гемопоэтических ниш, что впоследствии стимулировало метастазирование в костный мозг [104]. Кроме того, показано, что МСК формируют нишу стволовых опухолевых клеток и модулируют их функции, что усиливает метастатический процесс [105, 106]. Секретируя омега-3 жирные кислоты, МСК клетки опосредовали химиорезистентность опухолей [107] .

Помимо большого количества сообщений об участии МСК в прогрессии опухоли, в литературе существует множество данных об ингибировании этими клетками опухолевого роста. Стимулируя контактное торможение опухолевых клеток, внутривенно введенные мезенхимальные стволовые клетки костного мозга ингибировали рост саркомы Капоши [71]. МСК – важный источник различных паракринных факторов, которые способны подавлять рост опухоли. МСК пуповинной крови либо жировой ткани, внутривенно введнные мышам-носителям человеческой карциномы молочной железы, эффективно подавляли опухолевый рост и метастазирование [108]. Авторы данного исследования показали, что противоопухолевый эффект стволовых клеток был опосредован активированием каспазы 3, которая расщепляет фермент ПАРП-1, что делает процесс апоптоза необратимым. Внутриопухолевое введение МСК мышам-носителям меланомы В16 привело к значительному уменьшению плотности сосудов опухоли и инициированию каспаза-3зависимого апоптоза раковых клеток [72]. Установлено, что подкожное введение МСК, выделенных из фетальной кожи человека, вызывало подавление формирования рака печени и значительное уменьшение объема опухоли [70]. МСК жировой ткани супрессировали развитие опухолевого ксенотрансплантанта поджелудочной железы [109] .

Наконец, третьим вариантом взаимодействия опухолевых клеток и МСК является отсутствие влияния стволовых клеток на неопластический рост. МСК, совместно введенные с опухолевыми клетками рака молочной железы 4 Т1 либо внутривенно введнные через 4 дня после трансплантации опухоли, не оказывали влияние на рост опухолевых клеток [73]. Внутриопухолевое либо внутривенное введение МСК жировой ткани мышам – носителям карциномы шейки матки не ингибировало, но и не усиливало рост опухоли [11]. В исследовании, посвященном доставке интерферона бета мезенхимальными стволовыми клетками костного мозга, немодифицированные МСК не оказали статистически значимого воздействия на опухолевый рост и продолжительность жизни животныхопухоленосителей [5] .

В подобном исследовании МСК применяли для адресной доставки пролекарств, а в качестве контроля вводили немодифицированные стволовые клетки, которые не повлияли на рост карциномы предстательной железы [110] .

Таким образом, на сегодняшний день многочисленные исследования показали разнообразные эффекты стволовых клеток на канцерогенез. Повидимому, исход взаимодействия МСК и опухолевых клеток зависит от источника, степени дифференцировки, дозы МСК, типа раковых клеток, экспериментальной модели и от многих других причин. Для предсказания результата воздействия мезенхимальных стволовых клеток на неопластический рост необходимо выяснить основные механизмы их взаимовлияния .

1.5.1. Принципы регуляции опухолевого процесса мезенхимальными стволовыми клетками На настоящий момент установлены следующие принципы регуляции опухолевого процесса мезенхимальными стволовыми клетками: влияние на пролиферацию, ангиогенез, метастазирование опухоли, иммуномодулирующее воздействие, регуляция функций опухолевых стволовых клеток (Рис. 2) .

Рис.2. Функции мезенхимальных стволовых клеток в канцерогенезе .

(а) МСК способны стимулировать либо ингибировать пролиферацию опухолевых клеток .

(б) МСК влияют на ангиогенез опухоли .

(в) МСК оказывают иммуномодулирующее воздействие на опухолевый процесс .

(г) МСК способны влиять на метастазирование .

(д) Мезенхимальные стволовые клетки участвуют в формировании ниш опухолевых стволовых клеток и регулируют их функции .

МСК секретируют целый ряд паракринных факторов, которые способны влиять на пролиферацию опухолевых клеток. К ним относятся интерлейкины 6; 8; 13; трансформирующий фактор роста бета (TGF), факторы роста фибробластов (FGF), VEGF, инсулиноподобный (IGF) и тромбоцитарный (PDGF) факторы; ингибиторы металлопротеиназ 1-го и 2го типа; коллагены 1; 5; 6; 12; фибронектин и ряд хемокинов [100] .

Выделяемые мезенхимальными стволовыми клетками факторы могут как ингибировать, так и стимулировать пролиферацию опухолевых клеток .

Так, на модели рака молочной железы установлен молекулярный механизм подавления опухолевого роста мезенхимальными стволовыми клетками .

Установлено, что ростингибирующий эффект связан с действием секретируемого мезенхимальными стволовыми клетками протеина Dickkopf 1 (DKK-1), путем ингибирования сигнального пути WNT – катенин бета в опухолевых клетках [70]. В другой экспериментальной модели рака молочной железы показано, что мезенхимальные стволовые клетки стимулируют опухолевый рост путем секреции интерлейкина IL6 и хемокина CXCL7 [105] .

Одним из принципов регуляции опухолевого процесса мезенхимальными стволовыми клетками является влияние на ангиогенез .

МСК секретируют различные проангиогенные факторы, такие как VEGF, фактор роста фибробластов, PDGF и стромальный фактор-1 (SDF-1). Эти цитокины стимулируют эндотелиальную и мышечную миграцию в сайт опухоли, тем самым способствуя ангиогенезу [111, 112]. Было показано, что мезенхимальные стволовые клетки поддерживают ангиогенез опухоли путем дифференцировки в перициты и эндотелиальные клетки [113]. В противоположность этим данным есть и сообщения, что мезенхимальные стволовые клетки могут подавлять рост сосудов, выделяя супероксид азота, который индуцирует апоптоз эндотелиальных клеток [72] .

Фибробласты, которые являются основным типом клеток, включенным в опухолевую строму, являются одним из важнейших компонентов опухолевого микроокружения. Мезенхимальные стволовые клетки в опухолевом очаге под влиянием опухолевого микроокружения могут превращаться в фибробласты или же взаимодействовать с уже существующими опухолеассоциированными фибробластами. Установлено, что после культивирования стволовых клеток с опухолевым супернатантом МСК начинают экспрессировать антигены опухолеассоциированных фибробластов, такие как, гладко-мышечный актин, фибробласто-специфичный белок, виментин и SDF-1 [114, 115] .

Иммуносупрессивные свойства МСК изучены достаточно хорошо [116, 117], и нельзя исключить, что подавляя иммунные реакции и активность различных типов иммунных клеток (включая Т- и Влимфоциты, дендритные и киллерные клетки), они тем самым стимулируют рост опухоли. Возможно, в процессе взаимодействия МСК и опухолевых клеток играют роль и Toll-подобные рецепторы (TLR), которые распознают «сигналы опасности» и запускают реакции врожденного и приобретенного иммунитета, индуцируют как про-, так анти-воспалительные цитокины [118]. В то же время показано, что мезенхимальные стволовые клетки, подавляя реакцию «трансплантат против хозяина», отмечаемую при пересадке костного мозга, тормозят прогрессию лейкемии у больных, возможно, за счет задержки и подавления лейкемических клеток в костномозговых нишах [119] .

Стволовые клетки могут влиять на метастатический потенциал опухоли. Показано, что МСК синтезируют хемокин CCL5, для которого существует рецептор (CCLR-5) на опухолевых прометастатических клетках; после их взаимодействия происходит его активация и усиление метастазирования клеток рака молочной железы [89] .

МСК могут модулировать так называемый эпителиомезенхимальный переход, который, как считают многие исследователи, способствует приобретению опухолью более злокачественного инвазивного типа роста. Совместное культивирование клеток рака молочной железы и МСК приводило к усилению экспрессии на опухолевых клетках специфических маркеров этого перехода (таких как виментин, N-кадгерин, Twist, Snail) и снижению экспрессии Е-кадгерина [120] .

Доказано участие мезенхимальных стволовых клеток в формировании ниш опухолевых стволовых клеток и управлении их функциями путем регуляции активности костных морфогенетических белков BMP, простагландина PGE2 и белка катенина бета [105, 106]. МСК, дифференцируясь в миофибробласты опухоли, формируют и поддерживают нишы опухолевых стволовых клеток при участии белков BMP4, Wnt5a, IL-6, Gremlin-1, DKK, и Shh [121]. Показано, что секреция интерлейкина 1 опухолевыми клетками индуцирует выделение простагландина PGE2 мезенхимальными стволовыми клетками. PGE2 в сочетании с другими цитокинами МСК активизирует катенин бета сигнальные пути, что стимулирует образование опухолевых стволовых клеток [106] .

Обобщая приведенные данные, можно сказать, что мезенхимальные стволовые клетки могут влиять на различные опухолевые процессы:

пролиферацию, ангиогенез, метастазирование, иммунные реакции и формирование ниш опухолевых стволовых клеток. Обширные и разнообразные эффекты МСК связаны с широким спектром синтезируемых ими цитокинов и ростовых факторов, которые в различных экспериментальных моделях могут как подавлять, так и стимулировать опухолевый рост и метастазирование. Однако на сегодняшний день нет единого представления о опухолестимулирующих и опухолеингибирующих эффектах мезенхимальных стволовых клеток .

Поэтому новые экспериментальные данные будут полезными для разработки безопасных клинических протоколов клеточной терапии злокачественных и незлокачетсвенных заболеваний .

Заключение Клеточные технологии получили широкое применение в различных отраслях медицины. В последние годы растет число публикаций, посвященных применению клеточных технологий для противоопухолевой терапии .

Использование мезенхимальных стволовых клеток для доставки противоопухолевых препаратов основано на гипотезе о том, что в условиях канцерогенеза стволовые клетки мигрируют преимущественно в опухолевую ткань. Однако свойство МСК мигрировать в очаг новообразования не является абсолютно доказанным и требует дополнительного экспериментального подтверждения. Поскольку на сегодняшний день все больше появляется данных о том, что трансплантированные МСК обнаруживаются не только в опухолевой ткани, но и в других тканях, таких как печень, селезенка, головной мозг .

Большинство исследований хоуминга МСК в область опухолевого очага в основном ограничено изучением этого процесса только на животных-опухоленосителях. Логично было бы более детально изучить распределение трансплантированных клеток в организме реципиента как в норме, так и в условиях опухолевого роста. Поэтому выявление сходства и различий распределения трансплантированных МСК в норме и при патологии на разных сроках после трансплантации стало предметом наших исследований .

Кроме того, применение мезенхимальных стволовых клеток в противоопухолевой терапии в качестве доставщиков различных противораковых агентов либо в виде самостоятельного препарата на сегодняшний день ограничено из-за отсутствия единого представления о влиянии МСК на опухолевый процесс .

Необходимо подчеркнуть противоречивость имеющихся экспериментальных данных: согласно одним исследованиям МСК стимулируют рост опухоли, согласно другим, наоборот, МСК угнетают опухолевый рост. Кроме того, в литературе встречаются сообщения, свидетельствующие о том, что МСК не ингибируют и не стимулируют процесс неопластического роста. Учитывая противоречивость экспериментальных данных о влиянии мезенхимальных стволовых клеток на опухолевый процесс, актуальной задачей является изучение влияния трансплантации мезенхимальных стволовых клеток на кинетику неопластического роста опухоли и продолжительность жизни животных – носителей опухоли .

Глава II. МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

2.1. Выделение МСК из костного мозга мышей В работе использовались самцы и самки мышей линии С57ВL/6 в возрасте 8–12 недель. Животные находились на стандартной сбалансированной диете в питомнике ФБУН ГНЦ ВБ «Вектор» .

Эксперименты проводили с соблюдением принципов гуманности, изложенных в директивах Европейского сообщества (86/609/ЕЕС) и Хельсинкской декларации, в соответствии с «Правилами проведения работ с использованием экспериментальных животных» .

Мышей линии умерщвляли дислокацией шейных C57BL/6 позвонкови получали аспират костного мозга из бедренных и большеберцовых костей самцов мышей, который ресуспендировали в питательной среде Игла МЕМ (ФБУН ГНЦ ВБ «Вектор», Россия), содержащей 10 % сыворотки крови плодов коров (Gibco, США) .

Суспензию клеток помещали в культуральные флаконы и инкубировали при 37 0С, 100 % влажности, 5 % СО2 в течение 3 суток в СО2- инкубаторе .

Затем промывали полученные культуры клеток ростовой питательной средой, чтобы удалить неадгезировавшиеся клетки. Культивировали клетки в течение 7-10 суток с заменой ростовой питательной среды каждые 3 суток .

2.2. Культивирование МСК костного мозга Клетки выращивали в ростовой питательной среде Игла МЕМ с 10 % сыворотки крови плодов коровы, 200 мМ L-глютамина, 40 мкг/мл о гентамицина в CO2 инкубаторе при 37 С. Посевная концентрация составляла (1,0-2,0)106 клеток в 1 мл, кратность рассева 1:2, клетки пересевали каждые 7 10 суток. Для пересева культур клеток в качестве диспергента применяли 0,25 %-ный раствор трипсина (ФБУН ГНЦ ВБ «Вектор», Россия) и 0,02 %-ный раствор Версена (ФБУН ГНЦ ВБ «Вектор», Россия) в соотношении 1:2 .

–  –  –

2.4. Индукция адипогенной дифференцировки МСК Для индукции адипогенной дифференцировки МСК в ростовую среду добавляли 500 мкМ изобутилметилксантина (Sigma-Aldrich, США), 1 мкМ дексаметазона (Sigma-Aldrich, США), 10 мкг/мл инсулина (SigmaAldrich, США), 50 мкг/мл индометацина (Fluka, США). Через 3 недели культивирования дифференцированные клетки дважды промывали фосфатно-солевым буфером и фиксировали в растворе 4 %-ного формальдегида 60 мин при комнатной температуре, затем инкубировали в 0,6 %-ном растворе красителя красный масляный (Sigma-Aldrich, США) в течение 1 часа при комнатной температуре. Окрашенные клетки фотографировали с помощью фазово-контрастного микроскопа Axio Observer.A1 (Carl Zeiss Inc., Германия) .

2.5. Индукция остеогенной дифференцировки МСК Для индукции остеогенной дифференцировки МСК в ростовую питательную среду добавляли 100 нМ дексаметазона, 50 мкг/мл аскорбиновой кислоты (Sigma-Aldrich, США), 10 мМ глицерофосфата США). Через 3 недели культивирования (Sigma-Aldrich, дифференцированные клетки дважды промывали фосфатно-солевым буфером и фиксировали в растворе 4 %-ного формальдегида 60 мин при комнатной температуре, затем инкубировали в 2 %-ном растворе ализаринового красного (Sigma-Aldrich, США) 5-10 мин при комнатной температуре, затем отмывали от остатков красителя водой. Остеоциты фотографировали с использованием фазово-контрастного микроскопа Axio Observer.A1 (Carl Zeiss Inc., Германия) .

2.6. Иммунофенотипирование МСК Фенотип МСК, выделенных из костного мозга мышей, исследовали на проточном цитометре FACSCantoII (Becton Dickinson, США). Фенотип МСК исследовали с помощью моноклональных антител (Stem cell kits, RD Systems, США), меченых FITC (CD45), PE (CD34, CD73), APC CD105 .

2.7. Исследование миграционной активности МСК к опухолевым клеткам с помощью двухкамерной культуральной системы Для оценки миграционной способности in vitro культуру 5х104 МСК в 200 мкл бессывороточной питательной среды переносили на поликарбонатную мембрану (Chelikon, США) с диаметром пор 8 мкм. За 24 часа до эксперимента высевали клетки меланомы В16 в лунки 24луночного планшета в концентрации 100 000 клеток/лунка. Опухолевые клетки в лунках планшета промывали фосфатно-солевым буфером и заливали бессывороточной питательной средой Игла МЕМ (ФБУН ГНЦ ВБ «Вектор», Россия), затем инкубировали совместно с мезенхимальными стволовыми клетками 48 часов. Параллельно в качестве негативного контроля в лунки планшета добавляли бессывороточную питательную среду и инкубировали совместно с МСК в течение 48 часов. После этого неинвазивные мезенхимальные стволовые клетки удаляли с помощью ватного тампона. Мигрировавшие клетки окрашивали кристалл фиолетовым и подсчитывали количество окрашенных клеток в 10 полях зрения микроскопа. Микроскопию полученных препаратов проводили на инвертированном микроскопе Axio Observer.Z1 (х40). Затем вычисляли среднее количество клеток в одном поле зрения .

2.8. Оценка жизнеспособности опухолевых клеток с помощью МТТтеста Жизнеспособность опухолевых клеток меланомы В16-F10, которые предварительно совместно культивировали с МСК (опыт) либо бессывороточной питательной средой (контроль) в двухкамерной культуральной системе в течение 48 часов, оценивали на микропланшетном ридере Tecan Sunrise (Tecan, Австрия) при длине волны 492 нм по включению опухолевыми клетками 3-(4,5-диметилтиазол-2-ил)бромида (МТТ) (Sigma, США) и 2,5-дифенил-2Н-тетразолиум преобразования его в формазан митохондриальными дегидрогеназами .

Далее снимали значения оптической плотности субстрата в лунках .

Процент жизнеспособных опухолевых клеток вычисляли по формуле:

оптическая плотность раствора опыта / оптическая плотность раствора опыта 100 % .

2.9. Прижизненная окраска МСК красителем Хехст 33342 Для исследования распределения трансплантированных клеток в органах реципиента-опухоленосителя с помощью флуоресцентной микроскопии использовали метод прижизненной окраски клеток красителем Хехст 33342 (Sigma-Aldrich, США). Краситель Хехст 33422 проникает через неповрежденные мембраны и окрашивает ядра живых клеток в сине-зеленый цвет. Окраску проводили в ростовой питательной среде Игла МЕМ (ФБУН ГНЦ ВБ «Вектор», Россия) с добавлением 10 %ной сыворотки крови плодов коров, с красителем в конечной концентрации 1 мкг/мл в течение 5 минут, после чего клетки трижды промывали фосфатно-солевым буфером. Эффективность мечения оценивали при помощи флуоресцентного микроскопа Axio Observer.A1 (Carl Zeiss Inc., Германия). После мечения клеток красителем Хехст 33342 специфичность окрашивания ядер клеток составляла 100% .

2.10. Изучения распределения МСК в организме здоровых мышей и мышей-опухоленосителей Самкам мышей линии C57BL/6 в правую заднюю лапу подкожно вводили суспензию клеток меланомы B16-F10 в дозе 250 103 клеток/мышь в 200 мкл фосфатно-солевого буфера. Степень прививаемости опухоли животным составила 100% .

Через 3 дня после трансплантации опухолевых клеток животным в хвостовую вену внутривенно вводили суспензию мультипотентных мезенхимальных стромальных клеток самца в дозе 500 103 клеток/мышь в 500 мкл фосфатно-солевого буфера. Затем животные были разделены на 2 группы по 16 особей в каждой группе: первая группа для проведения количественного анализа содержания трансплантированных МСК с помощью ПЦР в реальном времени, вторая группа – флуоресцентной микроскопии. Через 1 час, 3, 7 и 14 суток после введения мезенхимальных стволовых клеток животных умерщвляли методом дислокации шейных позвонков. Опухоль, сердце, кожу, лимфатические узлы, легкие, печень, селезенку, головной мозг, костный мозг забирали для дальнейших исследований с помощью ПЦР либо флуоресцентной микроскопии .

2.11. Анализ выживаемости животных и изменения объема опухолей Через 3 дня после трансплантации животным меланомы B16-F10 (как описано выше), животные были разделены на 2 группы случайным образом, по 10 животных в каждой группе: животным первой группы внутривенно вводили суспензию МСК в дозе 500 103 клеток/мышь, животным второй группы – физиологический раствор. Контролем служили интактные животные. Через 12 суток после трансплантации опухоли и последующие дни до гибели животных измеряли объем опухоли, используя штангенциркуль. Изменение объема опухолей рассчитывали по формуле V = /6 AB2, A, B разнонаправленные размеры опухоли, см, как описано [122]. Животные находились в эксперименте до естественной гибели, после чего проводилась оценка достоверных различий выживаемости животных с помощью метода Каплан-Майера [123] .

2.12. Выделение ДНК Нативная ДНК, содержащая маркер трансплантированных клеток (специфическую последовательность выделяли при Y-хромосомы), помощи стандартной обработки додецилсульфатом натрия (SDS) с протеиназой К и методом высаливания [124] .

Чистоту и концентрацию выделенной ДНК определяли при помощи спектрофотометра SmartSpecTMSpectrophotometer (Bio-Rad Laboratories, США). Отношение поглощения при длинах волн 260 нм и 280 нм (260нм/280нм) показывает чистоту образца ДНК. Для дальнейших исследований были использованы образцы ДНК с отношением A260/A280 не менее 1,7. Для количественного анализа использовалась одинаковая концентрация всех образцов ДНК. Образцы ДНК до начала исследования были заморожены при температуре -20 oС .

2.13. Количественная полимеразная цепная реакция в режиме реального времени Количественную ПЦР в реальном времени выполняли с помощью прибора LightCycler 480 realtime PCR system (Roche Applied Science, Германия). Дизайн праймеров и зондов выполняли, использую программу Primer-BLAST. Количественный анализ содержания трансплантированных клеток костного мозга самца в органах самок проводили через оценку уровня специфической последовательности гена zinc finger protein 2 Y (Zfy2) хромосомы. Для амплификации специфической последовательности гена были использованы прямой праймер Zfy2 обратный праймер

5TCCAGGCTGGTCGCAAACTCATTT3,

зонд, 5ACATGAACAACGCCTTGGGCTTCA3; TaqMan конъюгированный с флуоресцентным красителем на 5 - конце и гасителем на 3конце Fam ~5'TCCACTGGCCTGTGTTGGCATTGCAGTTATBHQ1 (Медиген, Россия). В качестве внутреннего контроля выполняли амплификацию специфической последовательности гена бета актина с использованием прямого праймера и обратного праймера

5TGGCATTGTTACCAACTGGGACGA3

зонда, 5TTTCACGGTTGGCCTTAGGGTTCA3, TaqMan конъюгированного с флуоресцентным красителем на 5конце и гасителем на 3конце Hex (Медиген,

~5'TGGCACCACACCTTCTACAATGAGCTGCGT~BHQ1

Россия). Условия реакции амплификации: денатурация 95 °C в течение 5 минут, 40 циклов: денатурация 95 °C 20 сек., отжиг праймеров 62 °C 20 сек. и элонгация 72 °C 20 сек. В качестве негативного контроля использовали ткань интактных самок. Количественный анализ содержания трансплантированных клеток костного мозга самца в органах самок проводили через оценку уровня специфической последовательности гена Zfy2относительно количества специфического стандарта (положительного контроля) .

Для конструирования положительного контроля провели наработку фрагмента гена Zfy2 с помощью ПЦР. Полученный амплификационный продукт чистили с помощью QIAquick PCR Purification Kit (Qiagen, США) и встраивали в плазмиду pDrive (Qiagen, США) с использованием PCR Cloning Kit (Qiagen, США) согласно протоколу фирмы производителя .

Рекомбинантные плазмиды pDrive-Zfy2 выделяли с использованием QIAprep Spin Miniprep Kit (Qiagen, США). Наличие целевой вставки в выбранных гибридных плазмидах подтверждали с помощью рестрикционного анализа, ПЦР в реальном времени и секвенирования .

Концентрацию плазмиды определяли с помощью спектрофотометра Ultrospec 3000 Pro (Biochrom, Великобритания) .

Поскольку в клетках самца мышей содержится по 2 копии гена Zfy2, количество трансплантированных клеток в образце рассчитывалось по формуле: N=A/2, где N-количество Y-позитивных клеток, А-количество гена, определенного в образце .

2.14. Приготовление срезов на замораживающем микротоме Выделенные органы животных фиксировали в растворе фосфатносолевого буфера, содержащего 4 %-ный параформальдегид (рН 7,3-7,4) со скоростью 1 час на 2 мм ткани. Фиксированные образцы ткани помещали в 30 %-ный раствор сахарозы в расчете 1 час на 2 мм ткани. Затем образцы ткани заливали средой для замораживания срезов NEG 50 (Thermo Scientific, Германия) и помещали в жидкий азот. Из замороженных тканей готовили срезы толщиной 5-7 м с использованием криостата Thermo Scientific™ Microm HM 560 CryoStar Cryostat (Thermo Scientific, Германия), затем приготовленные срезы отмывали раствором фосфатносолевого буфера, содержащего 0,1 %-ный Triton X-100. Исследование распределения окрашенных трансплантированных клеток в органах реципиента оценивали с помощью лазерного сканирующего конфокального флуоресцентного микроскопа Zeiss LSM 510 (Carl Zeiss Inc., Германия) с использованием диодного лазера 405 нм .

2.15. Статистическая обработка полученных результатов Полученные результаты исследования статистически обрабатывали с использованием программы Statistica 6,0 for Windows (StatSoft, США) .

Полученные данные проверяли на нормальность распределения согласно критериям Колмогорова-Смирнова .

Количество трансплантированных клеток в органах реципиента, определенное с помощью количественной ПЦР, описано средней арифметической (М) и стандартным отклонением (S). Достоверность различий оценивали по критериям Манна-Уитни (в независимых группах) .

Различия считали достоверными при p0,01 [125] .

Глава III. РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЙ

3.1. Получение и морфофункциональная характеристика штамма мезенхимальных стволовых клеток костного мозга мышей линии C57BL/6 Мезенхимальные стволовые клетки костного мозга широко используют в различных экспериментальных моделях, в том числе для исследования свойств МСК и применения данного типа клеток в качестве средства доставки противоопухолевых агентов в клетки-мишени. В настоящее время получено большое количество мезенхимальных стволовых клеток из различных тканей и органов животных. Тем не менее, на сегодняшний день в Российской коллекции клеточных культур штаммы мезенхимальных стволовых клеток животных не зарегистрированы .

В Европейской коллекции клеточных культур аттестованы штаммы клеток животных, обладающих свойствами МСК, такие как m17.ASC (иммортализованные мезенхимальные стволовые клетки жировой ткани мыши), RMSC (R492-05) (мезенхимальные стволовые клетки костного мозга крысы) и FMSC (F492-05) (мезенхимальные стволовые клетки костного мозга кошки). Однако приобретение этих штаммов является достаточно дорогостоящим из-за затрат на транспортировку и таможенные расходы .

В рамках данного исследования в отделе клеточных технологий ФБУН ГНЦ ВБ «Вектор» получен и охарактеризован штамм мезенхимальных стволовых клеток из костного мозга мыши BMMSCC57BL/6. Из бедренных и большеберцовых костей самцов мышей линии C57BL/6 выделяли аспират костного мозга. Получение МСК из аспирата костного мозга мышей было основано на способности этих клеток адгезироваться к пластику при стандартных условиях культивирования .

Клетки МСК культивировали в течение 7-10 суток, каждые 3 суток проводили смену ростовой питательной среды. Клетки выращивали в ростовой питательной среде Игла МЕМ с 10 % сыворотки крови плодов коровы, 200 мМL-глютамина, 40 мкг/мл гентамицина в CO2 инкубаторе при 37 оС. Посевная концентрация составляла (1,0-2,0)106 клеток в 1 мл, кратность рассева 1:2, частота пассирования 7 10 суток. Для пересева культур клеток в качестве диспергента применяли 0,25 %-ный раствор трипсина и 0,02 %-ный раствор Версена в соотношении 1:2. Клетки исследовали на микробиологическую стерильность и отсутствие микоплазм. По данным микробиологического контроля при высеве на набор селективных сред было показано, что клетки штамма свободны от грибковой и бактериальной контаминации. Исследованием штамма после окрашивания ДНК-связывающим красителем Хехст 33342 было подтверждено отсутствие контаминации микоплазмой .

После проведения контролей и наработки достаточного количества материала клетки МСК криоконсервировали и на 5-ом пассаже. Для этого наработанную суспензию клеток ресуспендировали в среде для криоконсервации, содержащей 80% питательной среде Игла MEM, 10% сыворотки крови плодов коровы и 10% глицерина. Клетки разводили до концентрации 1,5106 в ампуле и замораживали до температуры минус 196 о С в жидком азоте. В результате было получено 8 ампул. Количество жизнеспособных клеток в результате восстановления после криоконсервации составляло 75-80% .

Исследованы морфологические признаки, культуральные свойства и видовая идентичность штамма BMMSC-C57BL/6. Клетки, выделенные из костного мозга мышей, характеризовались высокой степенью гетерогенности, которая выражалась в существовании в культуре разных клеточных типов, отличающихся по морфологии и скорости пролиферации. Первичная культура клеток была представлена как веретеновидными, треугольными и звездчатыми клетками с однородной цитоплазмой, так и клетками округлой или неправильной формы без отростков с неоднородной цитоплазмой. После проведения 3–4-х пассажей культура состояла преимущественно из веретеновидных фибробластоподобных клеток с небольшим овальным ядром, которые пролиферировали и формировали характерные потоки .

Кроме того, были исследованы культуральные свойства полученного штамма. Клетки BMMSC-C57BL/6субстрат-зависимы и поддерживаются на питательной среде Игла MEM с добавлением 10% сыворотки крови плодов коровы. После пересева клетки входят в лаг-период продолжительностью не менее 24 часов, который сменяется периодом экспоненциального роста .

В конце этого периода клетки достигают полного монослоя и входят в период покоя. Формирование клеточного монослоя завершалось через 7-10 суток после пересева (рис. 3).Культура клеток стабильна на протяжении 10-ти последовательных пассажей .

–  –  –

Рис. 3. Формирование клеточного монослоя штамма BMMSC-C57BL/6 в течение 7 суток(фазово-контрастная микроскопия). Увеличение х100 .

Видовую идентичность изучали методом ПЦР в режиме реального времени через оценку уровня специфической последовательности гена zinc finger protein 2 Y (Zfy2) хромосомы. Ген Zfy2 расположен на регионе Y хромосомы мышей, который определяет пол. Показано, что образцы ДНК, выделенной из клеток штамма содержали BMMSC-C57BL/6, специфическую последовательность гена Zfy2 .

Для подтверждения мезенхимальной природы клеток, полученных из костного мозга мышей, необходимо было оценить способность адгезироваться к пластику при стандартных условиях культивирования;

экспрессию молекул адгезии CD105, CD73и CD90 и отсутствие экспрессии CD45, CD34; способность дифференцироваться в остеобласты и адипоциты in vitro. Поэтому полученный штамм клеток был исследован на соответствие данным критериям .

После прохождения 3-4-х пассажей клетками штамма BMMSCC57BL/6 показано, что субпопуляция клеток с фенотипом CD73+ составляла 86,5 %, с фенотипом CD90+– 78,1 %, с фенотипом CD105+– 84,7 %, тогда как субпопуляция гемопоэтических клеток с фенотипом CD34+– 3,9 % и CD45+– 0,03 %, (рис.4) .

Рис. 4. Фенотипическая характеристика клеток штамма BMMSC-C57BL/6 после прохождения 3-4-х пассажей с использованием моноклональных антител, меченных FITC – CD45, PE – CD34, PE – CD73, APC – CD105 .

В ответ на адипогенную индукцию в течение 3-х недель исследуемые клетки формировали липидные включения, отчетливо заметные после окрашивания жирорастворимым красителем, что свидетельствовало о дифференцировке в адипоциты (рис. 5А) .

В ответ на остеогенную индукцию через 3 недели культивирования отмечено постепенное изменение морфологических особенностей стволовых клеток – клетки приобретали более округлую форму, внутри клеток появлялись специфические отложения кальция, что подтверждено окрашиванием ализариновым красным (рис. 5Б) .

А Б Рис. 5.

Результаты адипогенной и остеогенной индукции дифференцировки клеток штамма BMMSC-C57BL/6 (фазово-контрастная микроскопия):

А, культура дифференцированных в адипоцитыМСК на 21 сутки культивирования. Окраска масляным красным. Увеличение х100 .

Б, культура дифференцированных в остеоциты МСК на 21 сутки культивирования. Очаг минерализации окрашен ализариновым красным. Увеличение х100 .

–  –  –

Изучение миграционной активности МСК в условиях 3.2 .

опухолевого роста и влияния МСК на пролиферацию клеток линии В16-F10 в системе in vitro Исследование миграционной способности МСК к опухолевым клеткам в системе является отражением способности in vitro мезенхимальных стволовых клеток достигать очага опухолевого образования. Суть метода заключается в изучении направленного вертикального перемещения МСК сквозь поры специальной мембраны к опухолевым клеткам .

В результате проведенных экспериментов выявлено, что при инкубации МСК в присутствии опухолевых клеток меланомы В16-F10 миграционная активность мезенхимальных стволовых клеток была в 2,9 раз выше, чем при культивировании в бессывороточной питательной среде (рис. 6). Такое увеличение миграционной активности МСК к опухолевым клеткам вероятно можно объяснить действием опухолевых хемоаттрактантов, стимулирующих тропность МСК .

–  –  –

Рис. 6. Исследование миграционной активности МСК к опухолевым клеткам в системе in vitro .

А, схема эксперимента исследования миграционной активности мезенхимальных стволовых клеток к опухолевым клеткам с помощью двухкамерной культуральной системы. Исследуемые МСК помещали в специальные вставки с мембраной, имеющей поры. Вставки с МСК переносили в лунки планшета, в которых заранее культивировали опухолевые клетки. Далее клетки совместно культивировали в течение 48 часов. МСК за это время проникали сквозь поры мембраны и адгезировались на внешней стороне вставки .

Б, окрашенные кристалл фиолетовым МСК, которые мигрировали сквозь поры мембраны и адгезировались на внешней стороне вставки через 48 часов совместного культивирования с бессывороточной питательной средой (контроль) либо с опухолевыми клетками меланомы В16-F10 (опыт) .

В, гистограмма отображает среднее количество мигрировавших МСК к опухолевым клеткам меланомы В16-F10 (опыт) либо к питательной среде (контроль) в одном поле зрения .

Примечание: * - достоверность различия по сравнению с количеством МСК, мигрировавшим к питательной среде p 0,01 (U- критерий Манна-Уитни) .

Рис. 7. Влияние МСК на пролиферативную активность опухолевых клеток В16F10 в условиях совместного культивирования в двухкамерной культуральной системе .

Кроме того, нами было исследовано влияние на выживаемость опухолевых клеток В16-F10 при совместном культивировании с МСК в двухкамерной культуральной системе. Для этого МСК помещали в специальные вставки с мембраной, имеющей поры. Вставки с МСК переносили в лунки планшета, в которых заранее культивировали опухолевые клетки меланомы В16-F10. Далее клетки совместно культивировали в течение 48 часов. Параллельно в качестве негативного контроля опухолевые клетки культивировали в ростовой питательной среде в течение 48 часов. Влияние МСК на жизнеспособность опухолевых клеток оценивали с помощью МТТ – теста .

В результате проведенного исследования статически значимых различий между выживаемостью опухолевых клеток при совместной инкубации с МСК и со стандартной питательной средой не выявлено (рис .

7) .

–  –  –

Рис. 8.

Влияние внутривенной трансплантации МСК на кинетику роста меланомы В16-F10 и выживаемость животных – опухоленосителей:

А, схема эксперимента. Всем животным подкожно вводили суспензию опухолевых клеток меланомы В16-F10, через 3 суток после прививки опухоли внутривенно вводили мышам первой группы физраствор, мышам второй группы – мезенхимальные стволовые клетки .

Б, влияние внутривенной трансплантации МСК на кинетику роста меланомы В16. У всех животных в процессе исследования измеряли объем опухоли на 7, 10, 11, 12, 13 и 16 сутки после прививки опухоли. Статистически значимых различий объма опухолей групп с введением МСК и физраствора не выявлено. Данные представлены в виде среднего ± стандартное отклонение .

В, влияние трансплантации МСК на выживаемость животных – носителей опухоли оценивали с помощью метода Каплан-Майера. Значимые различия выживаемости животных с внутривенным введением стволовых клеток и физраствора по критерию Вилкоксона не обнаружены (p = 0,51, разницу считали достоверной при p 0,05) .

Самкам мышей линии C57BL/6 подкожно вводили суспензию клеток меланомы B16-F10. Через 3 дня после трансплантации опухолевых клеток животные были разделены на 2 группы случайным образом; животным первой группы внутривенно вводили физиологический раствор, животным второй группы – суспензию МСК. Контролем служили интактные животные. Через 12 суток после трансплантации опухоли и последующие дни до гибели животных измеряли объем опухоли. Животные находились в эксперименте до естественной гибели .

В результате проведенного исследования установлено, что внутривенное введение сингенных мезенхимальных стволовых клеток на 3 сутки после прививки опухоли мышам не повлияло на динамику развития опухоли (рис. 8Б). Ускорения роста опухоли не наблюдалось .

Анализ кривой выживаемости Каплана-Мейера показал, что статистически значимые различия между контрольной группой и группой с внутривенным введением МСК отсутствуют (р = 0,51) (рис. 8В) .

Таким образом, отсутствие статистически значимых различий между контрольной и опытной группой в проведенных испытаниях может свидетельствовать о безопасности применения мезенхимальных стволовых клеток на данной экспериментальной модели .

3.4. Количественное распределение трансплантированных МСК На следующем этапе проведено сравнительное исследование количественного распределения МСК в организме интактных животных и в условиях опухолевого роста на разных сроках после внутривенного введения методом ПЦР в реальном времени .

Для этого самкам мышей линии C57BL/6 подкожно вводили суспензию клеток меланомы B16-F10, через 3 дня после трансплантации опухолевых клеток животным в хвостовую вену внутривенно вводили суспензию МСК самца в дозе 500 103 клеток/мышь, параллельно – интактным животным внутривенно вводили МСК в той же дозе. Через 1 час, 3, 7 и 14 суток после введения стволовых клеток у животных забирали органы для дальнейших исследований с помощью ПЦР в режиме реального времени. Параллельно исследовали органы животных контрольной группы (интактные животные), которые забирали в те же сроки. Схема эксперимента представлена на рисунке 9 .

Рис. 9 Схема эксперимента исследования количественного распределения мезенхимальных стволовых клеток в норме и в условиях опухолевого роста на разных сроках после внутривенного введения методом ПЦР в реальном времени .

Забор органов животных для исследования количественного распределения трансплантированных клеток осуществляли в следующие условные стадии развития меланомы В16-F10:

Через 1 час после трансплантации стволовых клеток – ранний срок исследования (3 суток после прививки опухоли, опухолевый узел визуально не обнаруживался) .

Через 3 суток после трансплантации стволовых клеток – ранняя стадия канцерогенеза (6 суток после прививки опухоли, объем опухолевого узла составлял около 0,5 см3) .

Через 7 суток после трансплантации стволовых клеток – стадия сформированной опухоли (10 суток после прививки опухоли, объем опухолевого узла достигал 1 см3) .

Через 14 суток после трансплантации стволовых клеток – поздняя стадия канцерогенеза, когда в опухолевой ткани обнаруживались некротические изменения (17 суток после прививки опухоли, объем опухолевого узла достигал 2 см3) .

3.4.1. Распределение МСК в организме здоровых животных и животных – носителей меланомы В16-F10 через 1 час после трансплантации Результаты анализа количественного распределения МСК на раннем сроке (через 1 час) после трансплантации в организме здоровых животных и животных – носителей меланомы В16-F10, когда опухоль визуально не детектировалась, показаны на рисунке 10 .

Установлено, что максимальное количество МСК через 1 час после трансплантации в организме интактных животных и животных – носителей меланомы В16-F10 накапливается в легких (р 0,005) .

Кроме того, большое количество МСК выявлено в крови здоровых реципиентов ((550±40)/105) и мышей с привитой опухолью ((336±71)/105) .

((560±84)/105) В сердце интактных животных и животныхопухоленосителей ((292±32)/105) также обнаружено значительное число трансплантированных МСК .

Между накоплением введенных МСК в селезенке здоровых мышей ((147±40)/105) и мышей – опухоленосителей ((184±36)/105) статистически значимых отличий не выявлено (р = 0,56) .

Необходимо отметить, что в организме интактных животных МСК были детектированы в печени ((328±34)/105) и костном мозге ((11±3)/105), тогда как в условиях опухолевого роста в данных органах МСК не были обнаружены .

Отмечено небольшое количество МСК в лимфатических узлах ((76±13)/105) и головном мозге ((104±9)/105) мышей с привитой меланомой В16, при этом в норме в этих органах МСК не детектированы. На данном сроке в околоопухолевых лимфатических узлах и опухолевой ткани введенные МСК не выявлены .

Рис. 10. Распределение МСК в организме здоровых животных и животных – носителей меланомы В16 через 1 час после трансплантации клеток. Данные представлены в виде среднего ± стандартное отклонение .

Примечание: р – достоверность различия показателей накопления Y-позитивных клеток в органах интактных животных по сравнению с животными – опухоленосителями (U- критерий Манн-Уитни). Разницу считали достоверной при p 0,05 .

Таким образом, при внутривенном введении МСК мышам с привитой меланомой В16-F10 распределение этих клеток по органам и тканям в первый час после трансплантации не отличается от распределения у здоровых животных .

3.4.2. Распределение МСК в организме здоровых животных и животных – носителей меланомы В16-F10 через 3 суток после трансплантации Через 3 суток после трансплантации МСК объем опухоли достигал 0,5 см3, что составляет 25 % от максимального объема .

Установлено, что максимальное количество МСК через 3 суток после трансплантации в организме интактных животных и животных – носителей меланомы В16-F10 накапливается в сердце (р 0,005). При этом количество трансплантированных клеток в сердце животных – носителей меланомы В16-F10 ((2600±809)/105) достоверно выше (р = 0,0007), чем в сердце здоровых животных ((503±90)/105) .

Необходимо отметить, что через 3 суток после трансплантации как в норме, так и в условиях опухолевого роста МСК уже не детектировались в крови, что свидетельствует о миграции введенных МСК из кровеносного русла в строму органов .

Рис. 11. Распределение МСК в организме здоровых животных и животных – носителей меланомы В16-F10 через 3 суток после внутривенного введения клеток .

Данные представлены в виде среднего ± стандартное отклонение .

Примечание: р – достоверность различия показателей накопления Y-позитивных клеток в органах интактных животных по сравнению с животными – опухоленосителями (U- критерий Манн-Уитни). Разницу считали достоверной при p 0,05 .

В головном мозге мышей с привитой меланомой В16-F10 обнаружено достоверно более высокое число трансплантированных МСК ((1200±456)/105) по сравнению с этим органом интактных мышей ((62±6)/105) (р = 0,001) .

Количество введенных клеток в селезенке интактных мышей ((79±12)/105) было достоверно выше по сравнению с накоплением клеток в этом органом реципиентов – опухоленосителей ((12±4)/105) (р = 0,001) .

В лимфатических узлах ((27±3)/105), в ткани легких ((14±2)/105) и в костном мозге ((29±4)/105) интактных животных обнаружено небольшое число МСК, тогда как у мышей с привитой меланомой В16-F10 введенные клетки в этих органах не выявлены .

В отличие от нормы, в условиях онкогенеза трансплантированные стволовые клетки в незначительном количестве накапливались в печени ((36±6)/105) .

На данном сроке зарегистрировано значительное количество трансплантированных МСК в опухолевой ткани ((314±39)/105), но не выявлено в околоопухолевых лимфатических узлах .

3.4.3. Распределение МСК в организме здоровых животных и животных – носителей меланомы В16-F10 через 7 суток после трансплантации Через 7 суток после трансплантации МСК объем опухоли достигал 0,5 см3, что составляет 50 % от максимального объема .

Необходимо отметить, что через неделю после трансплантации количество трансплантированных МСК в исследуемых органах здоровых реципиентов значительно снизилось. Единичные трансплантированные клетки обнаружены в печени ((3±1)/105), селезенке ((3±1)/105), костном мозге ((4±1)/105) и головном мозге ((12±2)/105) здоровых животных (рис .

12) .

В отличие от распределения МСК в организме здоровых реципиентов, у реципиентов с привитой меланомой В16-F10 отмечено значительное количество МСК в костном мозге ((5850±1519)/105), что статистически значимо выше, чем накопление МСК в костном мозге ((4±1)/105) интактных животных (р = 0,0003) .

Рис. 12. Распределение МСК в организме здоровых животных и животных – носителей меланомы В16-F10 через 7 суток после трансплантации клеток. Данные представлены в виде среднего ± стандартное отклонение .

Примечание: р – достоверность различия показателей накопления Y-позитивных клеток в органах интактных животных по сравнению с животными – опухоленосителями (U- критерий Манн-Уитни). Разницу считали достоверной при p 0,05 .

В опухолевой ткани через неделю после трансплантации клеток также отмечено небольшое число МСК ((30±8)/105) .

Кроме того в печени ((4±1)/105), селезенке ((5±1)/105), легких ((4±1)/105), головном мозге ((5±1)/105), лимфатических узлах ((3±1)/105) и сердце ((3±1)/105) животных – носителей меланомы В16 детектированы единичные МСК .

Таким образом, можно сделать вывод, что опухолевый процесс стимулирует миграцию и/или пролиферацию МСК в костном мозге через неделю после трансплантации МСК на стадии сформированной опухоли .

3.4.4. Распределение МСК в организме здоровых животных и животных – носителей меланомы В16-F10 через 14 суток после трансплантации Через 14 суток после трансплантации МСК объем опухоли достигал максимального объема 2 см3, в ткани опухоли начинались некротические процессы .

В костном мозге мышей – носителей меланомы В16-F10 выявлено 2010/105, значительное количество МСК (среднее – стандартное отклонение – 540/105), что достоверно выше чем количество МСК в костном мозге здоровых животных (среднее – 39/105, стандартное отклонение – 8/105) (р = 0,00007) .

Помимо этого в околоопухолевых лифатических узлах обнаружено большое число МСК (среднее – 460/105, стандартное отклонение – 140/105), тогда как в остальных лимфатических узлах мышей – опухоленосителей введенные клетки не найдены, что доказывает влияние опухолевого процесса на распределение МСК .

В сердце животных с привитой опухолью также детектированы трансплантированные МСК (среднее – 83/105, стандартное отклонение – 17/105), тогда как у здоровых животных в этом органе клетки не выявлены .

Установлено статистически значимо более высокое содержание МСК в головном мозге мышей – носителей опухоли (среднее – 20/105, стандартное отклонение – 7/105) по сравнению с накоплением МСК в этом органе интактных мышей (среднее – 4/105, стандартное отклонение – 1/105) (р = 0,003) .

~ Рис. 13. Распределение МСК в организме здоровых животных и животных – носителей меланомы В16 через 14 суток после трансплантации клеток. Данные представлены в виде среднего ± стандартное отклонение .

Примечание: р – достоверность различия показателей накопления Y-позитивных клеток в органах интактных животных по сравнению с животными – опухоленосителями (U- критерий Манн-Уитни). Разницу считали достоверной при p 0,05 .

Между количеством МСК ткани селезенки здоровых мышей (среднее – 17/105, стандартное отклонение – 8/105) и мышей с привитой 22/105, 10/105) опухолью – стандартное отклонение – (среднее статистически значимых различий не выявлено .

На данном сроке выявлено небольшое число МСК в крови интактных мышей (среднее – 35/105, стандартное отклонение – 7/105), тогда как в кровеносном русле мышей – носителей меланомы В16 трансплантированные клетки не выявлены .

Стоит также отметить, что через 2 недели после трансплантации клеток МСК в опухолевой ткани не выявлены .

Таким образом, можно сделать вывод, что опухолевый процесс стимулирует миграцию и/или пролиферацию МСК в костный мозг через неделю после трансплантации МСК на стадии сформированной опухоли .

3.4.5. Кинетика накопления МСК в различных органах здоровых животных и животных-носителей опухоли в течение 14 суток Кинетика накопления трансплантированных МСК в печени, селезенке, легких, сердце и костном мозге здоровых животных и животных

– носителей меланомы В16-F10 была прослежена в течение 14 суток .

В легких интактных мышей и животных – носителей опухоли количество МСК достигло максимума через 1 час после трансплантации клеток (рис. 14 А). Число МСК в легких здоровых мышей через 1 час после введения клеток достоверно выше, чем через 3 суток после трансплантации (р = 0,002), а на более поздних сроках (через 7 и 14 суток после введения) стволовые клетки в данном органе не обнаружены. В легких мышей – опухоленосителей через 1 час после трансплантации МСК число введенных клеток достоверно выше, чем через 7 суток после введения (р = 0,003). Через 3 и 14 суток после введения у мышей – носителей опухоли МСК в ткани легких не обнаружены .

В печени интактных реципиентов через 1 час после введения выявлено большое количество МСК, статистически более высокое чем через 7 суток после трансплантации (р = 0,0007), через 3 и 14 суток после введения трансплантированные клетки в печени здоровых реципиентов не детектированы (рис. 14 Б). Незначительное количество МСК в печени реципиентов – носителей опухоли отмечено через 3 и 7 суток после введения, однако число МСК через 3 суток достоверно выше чем через 7 суток после введения (р = 0,0018). Между количеством МСК ткани печени здоровых мышей и мышей с привитой опухолью через 7 суток после введения клеток статистически значимых различий не выявлено .

Трансплантированные МСК в селезенке здоровых мышей и мышей – носителей меланомы В16-F10 обнаружены на всех исследуемых сроках (рис. 14 В). Максимальное количество МСК в селезенке здоровых животных и животных – опухоленосителей накапливалось через 1 час после введения (р 0,05). Установлено, что через 3 суток после трансплантации содержание стволовых клеток в селезенке здоровых животных достоверно выше, чем в селезенке опухоленосителей (р = 0,001), в остальные сроки исследования статистически значимых различий между этими показателями не выявлено .

В сердце интактных животных МСК обнаружены только на ранних сроках после введения (1 час и 3 суток), причем через час после трансплантации клеток число МСК достоверно более высокое, чем через 3 суток (p = 0,001) (рис. 14 Г). В сердечной ткани животных – опухоленосителей МСК детектированы на всех сроках после введения, максимальный показатель накопления МСК отмечен через 3 суток после введения (р 0,05), а минимальный показатель – через 7 суток (р 0,05) .

Трансплантированные МСК в костном мозге интактных мышей обнаружены на всех исследуемых сроках (рис. 14 В), при этом число введенных клеток в этом органе здоровых животных не превышало показатель 40/105. Тогда как у мышей – носителей меланомы В16 введенные клетки в костном мозге выявлены только на поздних сроках исследования (на 7 и 14 сутки), при этом количество МСК у животных – опухоленосителей было достоверно выше чем у здоровых животных (р 0,05) .

Кроме того, нами исследована кинетика накопления МСК в опухолевой ткани в течение 14 суток (рис. 15). Необходимо отметить, что МСК в опухолевой ткани реципиентов обнаружены через 3 и 7 суток после трансплантации. При этом максимальное количество введенных клеток в ткани опухоли отмечено через 3 суток после трансплантации, то есть на ранней стадии канцерогенеза (р = 0,003) .

–  –  –

Рис. 14. Кинетика накопления МСК в течение 14 суток: А – легкие, Б – печень, В – селезенка, Г – сердце, Д – костный мозг .

Примечание:

* – достоверность различия показателей накопления Y-позитивных клеток (U- критерий Манн-Уитни) .

–  –  –

Рис. 15. Кинетика накопления МСК в опухолевой ткани мышей носителей меланомы В16 в течение 14 суток после трансплантации стволовых клеток .

Таким образом, можно заключить, что опухолевый процесс повлиял на кинетику накопления МСК в печени, легких, сердце и костном мозге и не оказал влияние на накопление стволовых клеток в селезенке. При внутривенном введении мезенхимальные стволовые клетки в опухолевой ткани на модели меланомы В16-F10 максимально накапливались на ранней стадии канцерогенеза, когда опухолевый узел достигал 0,5 см3 .

3.5. Исследование распределения МСК в организме животных – носителей меланомы В16-F10 при помощи флуоресцентной микроскопии Для дополнительного подтверждения результатов ПЦР была выполнена флуоресцентная микроскопия срезов органов мышей с привитой меланомой В16-F10, которым вводили флуоресцентно меченные МСК .

Для исследования распределения трансплантированных МСК в органах реципиента-опухоленосителя с помощью флуоресцентной микроскопии МСК до трансплантации окрашивали красителем Хехст

33342. Окраску проводили в ростовой питательной среде с красителем в конечной концентрации 1 мкг/мл в течение 5 минут, после чего клетки трижды промывали фосфатно-солевым буфером. Эффективность мечения оценивали при помощи флуоресцентного микроскопа Axio Observer.A1 .

После мечения клеток красителем Хехст 33342 специфичность окрашивания ядер клеток составляла 100 %, что показано на рисунке 16 .

Рис. 16. МСК костного мозга, окрашенные красителем Хехст 33342. Краситель Хехст 33342 окрашивает ядра клеток (показано стрелкой). х 200 .

Самкам мышей линии C57BL/6 подкожно вводили суспензию клеток меланомы B16-F10, через 3 дня после этого животным в хвостовую вену внутривенно вводили суспензию флуоресцентно меченных МСК самца в дозе 500 103 клеток/мышь. В качестве контроля по аналогичной схеме самкам мышей вводили не окрашенные клетки костного мозга самцов мышей. Через 1 час, 3, 7 и 14 суток после введения мезенхимальных стволовых клеток животных умерщвляли методом дислокации шейных позвонков. Опухоль, сердце, кожу, лимфатические узлы, легкие, печень, селезенку, головной мозг, костный мозг забирали для дальнейших исследований с помощью флуоресцентной микроскопии. Выделенные органы животных фиксировали, замораживали и из полученных органов готовили срезы. Детекцию флуоресцентно меченых МСК в тканях проводили с помощью флуоресцентного микроскопа на гистологических препаратах толщиной 7 мкм, изготовленных на криостатном микротоме .

Через 1 час после введения МСК методом флуоресцентной микроскопии меченные клетки были обнаружены в срезах ткани легкого, сердца и селезенки (рис. 17), что подтверждает результаты, полученные с помощью ПЦР. В остальных исследованных органах меченные клетки не детектированы, тогда как методом ПЦР через 1 час после введения небольшое количество трансплантированных клеток также выявлено в лимфатических узлах и головном мозге мышей с привитой меланомой В16-F10 .

–  –  –

Б – флуоресцентная микроскопия ткани сердца. 200 .

В – флуоресцентная микроскопия ткани селезенки. 200 .

Рис. 17. Флуоресцентная микроскопия срезов органов мышей – носителей меланомы В16-F10 через 1 час после трансплантации МСК .

Через 3 суток после трансплантации МСК флуоресцентные клетки определялись в срезах ткани сердца, головного мозга и опухолевой ткани (рис. 18), что совпадает с результатами ПЦР. В остальных исследованных органах окрашенные МСК не выявлены, тогда как с помощью ПЦР небольшое число введенных клеток также обнаружено в селезенке и печени мышей-опухоленосителей .

Фазово-контрастная Конфокальная лазерная Фазовый контраст и микроскопия флуоресцентная флуоресценция синего микроскопия, синий канал канала (наложение) А – флуоресцентная микроскопия сердца. 200 .

Б – флуоресцентная микроскопия головного мозга. 200 .

В – флуоресцентная микроскопия опухолевой ткани. 200 .

Рис. 18. Флуоресцентная микроскопия срезов органов мышей – носителей меланомы В16-F10 через 3 суток после трансплантации МСК .

Через 7 суток после трансплантации (стадия сформированной опухоли) МСК, окрашенные красителем Хехст 33342, были обнаружены в срезах костного мозга и опухолевой ткани (рис. 19). Методом ПЦР у реципиентов с привитой меланомой В16-F10 также определено значительное количество МСК в этих органах. В других исследованных органах методом флуоресцентной микроскопии стволовых клеток выявить не удалось, тогда как с помощью ПЦР единичные клетки были обнаружены в печени, селезенке, легких, головном мозге, лимфатических узлах и сердце .

Фазово-контрастная Конфокальная лазерная Фазовый контраст и микроскопия флуоресцентная флуоресценция синего микроскопия, синий канал канала (наложение) А – флуоресцентная микроскопия костного мозга. 200 .

Б – флуоресцентная микроскопия опухолевой ткани. 200 .

Рис. 19. Флуоресцентная микроскопия срезов органов мышей – носителей меланомы В16-F10 через 7 суток после трансплантации МСК. 200 .

Через 14 суток после введения стволовых клеток (поздняя стадия канцерогенеза) меченные МСК обнаружены в срезах костного мозга и околоопухолевого лимфатического узла (рис. 20). Методом ПЦР также значительное число трансплантированных клеток выявлено в костном мозге и околоопухолевых лимфатических узлах. С помощью флуоресцентной микроскопии в остальных органах флуоресцентно окрашенные клетки не детектированы, тогда как методом ПЦР МСК также определены в сердце, головном мозге и селезенке .

Фазово-контрастная Конфокальная лазерная Фазовый контраст и микроскопия флуоресцентная флуоресценция синего микроскопия, синий канал канала (наложение) А – флуоресцентная микроскопия костного мозга. 200 .

Б – флуоресцентная микроскопия околоопухолевого лимфатического узла. 200 .

Рис. 20. Флуоресцентная микроскопия срезов органов мышей – носителей меланомы В16-F10 через 14 суток после трансплантации МСК .

Таким образом, нами установлено удовлетворительное качественное соответствие результатов, полученных при помощи флуоресцентной микроскопии и ПЦР в реальном времени. С помощью флуоресцентной микроскопии удалось выявить меченные МСК в тех органах, в которых подтверждено максимальное накопление клеток с помощью ПЦР. В органах, в которых с помощью ПЦР выявлено менее 200 МСК на 100 000 клеток органа реципиента – опухоленосителя, методом флуоресцентной микроскопии стволовые клетки выявить не удалось. Данный факт свидетельствует о высокой чувствительности метода ПЦР в реальном времени .

ГЛАВА IV. ОБСУЖДЕНИЕ РЕЗУЛЬТАТОВ ИССЛЕДОВАНИЯ

Высокая токсичность противоопухолевых препаратов является серьезным препятствием на пути развития терапии злокачественных новообразований. Одним из перспективных способов повышения эффективности противоопухолевых соединений является создание систем доставки на основе мезенхимальных стволовых клеток .

Применение мезенхимальных стволовых клеток для адресной доставки противоопухолевых препаратов основано на предположении о том, что в условиях канцерогенеза стволовые клетки мигрируют исключительно в опухолевую ткань. Направленная миграция в область локализации опухолевого очага впервые была показана в работе М .

Studeny, в которой авторы использовали МСК для доставки интерферона бета [4]. Позднее МСК были использованы в качестве транспортеров к опухолям различных противоопухолевых агентов, таких как интерфероны, цитокины, химиопрепараты, индукторы рецепторного апоптоза, онколитические вирусы и другие [100]. Однако на сегодняшний день появляются сообщения о том, что МСК после трансплантации детектируются не только в опухолевом очаге, но и в других тканях, таких как селезенка, печень, головной мозг [10, 11, 61] .

Учитывая противоречивость имеющихся данных о миграционной активности МСК в опухолевую ткань, актуальной задачей является установление особенностей распределения МСК после внутривенной трансплантации в условиях канцерогенеза, чему и посвящено данное исследование .

МСК были успешно выделены из большого количества органов, включая костный мозг, головной мозг, печень, почки, легкие, мышцы, тимус, поджелудочную железу, кожу, жировую ткань, пуповины, плаценты и вартониев студень [126, 127, 128]. Среди перечисленных органов наиболее перспективными, с позиций применения для клеточной терапии, считаются МСК костного мозга. К основным преимуществам МСК, выделенных из костного мозга, относятся исключение риска ятрогенного инфицирования, а также аутологичность клеточного материала, что позволяет отказаться от гетеро- или аллотрансплантаций, сопряженных с решением проблем гистосовместимости, этических и юридических вопросов .

В рамках проведенной работы нами получен штамм мезенхимальных стволовых клеток из костного мозга мышей линии C57BL/6, а также исследованы культуральные и морфофункциональные свойства полученных клеток.

В 2006 году Комитетом по стволовым клеткам Международного общества клеточной терапии был введен минимум критериев для определения мезенхимальных стволовых клеток [129]:

способность адгезироваться к пластику при стандартных условиях культивирования; экспрессия молекул адгезии CD105, CD73и CD90 и отсутствие экспрессии CD45, CD34; способность дифференцироваться в остеобласты, адипоциты и хондробласты in vitro. Поэтому полученная культура клеток была оценена на соответствие критериям, предложенных Комитетом по стволовым клеткам Международного общества клеточной терапии в 2006 году. В результате было показано, что свойства полученного штамма клеток из костного мозга удовлетворяют критериям, предложенным международным обществом клеточной терапии, и позволяют отнести их к мезенхимальным стволовым клеткам .

Возможность применения МСК для клеточной терапии рака зависит от способности этих клеток к миграции в очаг локализации новообразования. Миграция МСК in vitro под влиянием различных сигнальных молекул, которые выделяют раковые клетки, имитирует процесс миграции in vivo [48] .

Нами оценена миграционная активность МСК к клеткам меланомы В16 с помощью двухкамерной культуральной системы in vitro. В результате проведенных экспериментов выявлено, что при инкубации МСК в присутствии опухолевых клеток меланомы В16 миграционная активность МСК была в 2,9 раз выше по сравнению с контролем. Такое увеличение миграционной активности МСК к опухолевым клеткам вероятно можно объяснить действием опухолевых хемоаттрактантов, стимулирующих тропность МСК. Полученные нами результаты соответствуют литературным данным, описывающим увеличение миграционной активности МСК, выделенных из костного мозга мышей, к кондиционной среде, полученной после культивирования клеток мышиной карциномы молочной железы [90] .

Кроме того, нами было изучено влияние МСК на выживаемость клеток меланомы В16 in vitro. В результате установлено, что совместное культивирование МСК с опухолевыми клетками меланомы В16 не оказало влияние на жизнеспособность раковых клеток данной клеточной линии .

В отличие от полученных нами результатов, Лю с соавторами показали, что МСК ингибируют опухолевый рост в экспериментах in vitro .

МСК, выделенные из костного мозга мышей, совместно культивировали с клеточными линиями мышиной гепатомы, лимфомы и крысиной инсулиномы. В результате показано, что МСК ингибируют рост мышиных опухолевых клеточных линий in vitro зависимым от концентрации МСК образом. Авторами доказано, что МСК стимулируют экспрессию р21 – ингибитора G1 – фазы клеточного цикла и ряда проапоптотических белков По-видимому, различия полученных нами результатов и [98] .

литературных данных обусловлены использованием различных опухолевых клеточных линий, возможно, результат воздействия МСК на опухолевый рост зависит от типа исследуемых раковых клеток .

Следующим закономерным этапом работы была оценка влияния внутривенной трансплантации МСК на среднюю продолжительность жизни животных реципиентов – опухоленосителей и на динамику роста опухоли. Для исследования влияния трансплантации МСК на опухолевый рост нами была выбрана модель меланомы В16, которая характеризуется коротким инкубационным периодом, быстрым ростом и типичным метастазированием. В результате нами установлено, что однократное внутривенное введение МСК через 3 дня после прививки меланомы В16 мышам линии C57BL/6 не привело к усилению опухолевого роста .

Ранее было показано, что МСК костного мозга мышей увеличивали заболеваемость животных раком при совместном введении МСК и клеток меланомы В16 зависимым от дозы стволовых клеток образом. Авторы статьи связывают этот эффект с иммуносупрессивными свойствами МСК [130]. В другой работе показано, что совместное введение сингенных МСК костного мозга мышей с клетками меланомы В16 либо карциномы Льюиса вызывало подавление опухолевого роста и метастазирования этих типов рака [68]. Эти исследования характеризуются тем, что стволовые клетки вводят совместно с опухолевыми клетками, в нашей работе сингенные МСК трансплантировали мышам – носителям меланомы В16 через 3 дня после прививки опухоли. В связи с этим можно предположить, что срок трансплантации МСК (совместное введение с опухолевыми клетками, введение МСК на ранних или поздних стадиях канцерогенеза) является важным фактором, определяющим исход воздействия стволовых клеток на опухолевую прогрессию .

Выживаемость животных – опухоленосителей является важным критерием оценки препаратов, ориентированных на применение в клинике различных новообразований. Поэтому мы проанализировали влияние внутривенной трансплантации МСК на выживаемость животных – носителей меланомы В16 с помощью метода Каплан-Мейера. Как показали проведнные нами исследования, введение сингенных МСК костного мозга мышам с сингенной меланомой В16 не привело к снижению выживаемости животных-опухоленосителей .

Полученные нами данные о влиянии внутривенной трансплантации МСК на продолжительность жизни животных – носителей опухоли не противоречат литературным данным. Так, например, в работе, посвященной применению МСК для адресной доставки интерферона бета в опухолевый очаг, показано, что внутривенная трансплантация МСК через 8 дней после прививки опухоли не привела к статистически значимому уменьшению или увеличению выживаемости животных [5] .

Изучение распределения МСК в организме реципиента после трансплантации является одним из основных доклинических данных, необходимых для обеспечения безопасности проведения клеточной терапии. При этом должны быть оценены следующие риски: риски накопления МСК в нецелевых органах и тканях, изменение стволовыми клетками функционирования органа, риск формирования нежелательной ткани или опухоли после клеточной терапии. На распределение МСК после трансплантации оказывает влияние множество факторов, таких как способ введения клеток, экспериментальная модель, источник МСК (костный мозг, жировая ткань, пуповинная кровь и другие), срок проведения исследования после трансплантации клеток (1 час, сутки, месяцы) .

Для того, чтобы выяснить, влияет ли опухолевый процесс на миграцию трансплантированных МСК, мы исследовали сходства и различия распределения МСК в организме интактных животных и животных – носителей меланомы В16 на разных сроках после трансплантации .

Для исследования распределения МСК после трансплантации в организме здоровых животных и реципиентов – носителей опухоли было принято решение использовать внутривенное введение клеток. Данное решение обусловлено тем, что внутривенная трансплантация клеточного материала является наиболее безопасным способом введения клеток в организм по сравнению с внутриартериальным, интратрахеальным, внутриопухолевым и другими методами доставки клеток в организм. К основным преимуществам внутривенного введения МСК по сравнению с вышеперечисленными методами относятся: возможность введения МСК в достаточно высоких дозах в течение длительного времени, отсутствие необходимости хирургического вмешательства, меньшая травматичность операции, а вследствие этого и возможность повторного введения МСК [131] .

Немаловажным фактором, определяющим распределение клеток после трансплантации, является выбор экспериментальной модели:

сингенная или ксеногенная трансплантация МСК и опухоли [10, 5]. Для нивелирования фактора влияния видоспецифичных хемоаттрактантов при ксеногенной трансплантации было принято решение использовать сингенную трансплантацию МСК костного мозга мышам – носителям сингенной меланомы В16 .

Важным аспектом изучения распределения МСК после трансплантации является способ исследования распределения клеток. Из множества методов изучения распределения трансплантированных клеток мы остановились на полимеразной цепной реакции в реальном времени .

Этот метод определения маркера трансплантированных клеток (специфическая последовательность Y - хромосомы) в исследуемом материале позволяет описать количественную динамику введенных клеток в организме реципиента. К преимуществам применяемого нами подхода относится отсутствие каких либо воздействий на изучаемые клетки, абсолютная стабильность метки в течение неограниченного времени, отсутствие вероятности элиминирования во время жизнедеятельности клеток, высокая чувствительность метода [132] .

Исследование количественного распределения трансплантированных МСК осуществляли в следующие условные стадии развития меланомы В16: 1 час после трансплантации МСК – ранний срок исследования; 3 суток после введения МСК – ранняя стадия канцерогенеза; 7 суток после трансплантации МСК – стадия сформированной опухоли; 14 суток после трансплантации стволовых клеток – поздняя стадия канцерогенеза, когда в опухолевой ткани обнаруживались некротические изменения .

Нами установлено, что максимальное количество МСК через 1 час после внутривенной трансплантации в организме интактных животных и животных – носителей меланомы В16 накапливается в легких. Кроме того, по данным проведенной флуоресцентной микроскопии показано, что в легких флуоресцентно окрашенные МСК регистрировались в просветах капилляров межальвеолярных перегородок мышей – носителей меланомы В16 .

Рядом авторов в различных экспериментальных моделях показано, что МСК на ранних сроках после внутривенного введения в большом количестве обнаруживаются в легких реципиента [133, 134, 131]. Это связано с тем, что после внутривенной трансплантации МСК, двигаясь с кровотоком по малому кругу кровообращения, попадают в легкие реципиента, где задерживаются в узких легочных капиллярах. Показано, что предварительное введение системного вазодилататора – нитропруссида натрия приводит к достоверному увеличению количества циркулирующих в крови МСК и уменьшению фракции этих клеток, задержавшихся в легких мышей [135] .

В другом исследовании проведен анализ распределения трансплантированных мышиных МСК в организме здоровых мышей линии Balb/c и мышей той же линии с подкожно привитой опухолью молочной железы методом биолюминесцентной визуализации. В организме здоровых мышей специфический сигнал МСК детектировался через 1 час после введения МСК в легких реципиента и постепенно снижался вплоть до полного исчезновения через 1 сутки после трансплантации. Через 4, 6, 9 и 11 дней после введения МСК биолюминесцентный сигнал в организме здоровых мышей не зарегистрирован [73]. Возможно, причины расхождения полученных нами результатов с литературными данными связаны с применением различных методов детектирования МСК после трансплантации. Использованный нами метод ПЦР в реальном времени обладает чрезвычайно высокой чувствительностью – до 1 копии целевой геномной ДНК в исследуемой пробе. Тогда как метод биолюминесцентной визуализации ограничен глубиной проникновения волны эмиссии метки в ткани [132] .

Помимо накопления МСК в легких, трансплантированные клетки были обнаружены в сердце, крови и селезенке здоровых животных и животных с привитой опухолью. Полученные нами результаты соответствуют литературным данным о том, что после внутривенного введения МСК через двое суток после трансплантации крысам с индуцированным инфарктом миокарда, введенные клетки детектировались не только в легких, но и в сердце, селезенке и печени [136] .

Исследование распределения МСК с помощью флуоресцентной микроскопии также показало присутствие трансплантированных клеток в красной пульпе селезенки мышей – носителей меланомы В16. По результатам ПЦР трансплантированные МСК в селезенке здоровых животных и животных – носителей меланомы В16 были обнаружены на всех исследуемых сроках. Красная пульпа селезенки отвечает за фагоцитоз инородных частиц, возможно часть введенных МСК погибает и постепенно утилизируется в этом органе. Показано, что МСК человека, введенные иммунодефицитным мышам, были обнаружены в красной пульпе и маргинальной зоне селезенки. Авторы статьи считают, что таким образом ретикуло-эндотелиальная система реципиента фагоцитирует клеточный дебрис [10] .

Кроме того, нами установлены различия в распределении МСК в норме и в условиях опухолевого роста: в отличие от нормы в условиях опухолевого роста МСК в небольшом количестве мигрируют в лимфатические узлы и головной мозг. В отличие от распределения МСК в условиях опухолевого роста в организме интактных животных введенные клетки детектированы в печени, коже и костном мозге. Таким образом, нам удалось установить, что даже на раннем сроке исследования опухолевый процесс оказывает влияние на распределение трансплантированных МСК по органам реципиента .

Через 3 суток после трансплантации МСК максимальное количество трансплантированных клеток в организме интактных животных и животных – носителей меланомы В16 накапливалось в сердце. Оценка приживления введенных МСК с помощью флуоресцентной микроскопии показала, что окрашенные клетки аккумулированы во внутренней оболочке сердца – эндокарде животных – опухоленосителей .

В селезенке, костном мозге, легких, головном мозге, лимфатических узлах и коже интактных животных обнаружено небольшое количество МСК. Тогда как в организме мышей с привитой опухолью основная масса МСК аккумулирована в сердце, головном мозге и в опухолевой ткани, и лишь незначительное количество клеток зафиксировано в селезенке и печени .

Кроме того, по результатам проведенных нами экспериментов выявлено значительное количество введенных МСК в головном мозге через 3 суток после трансплантации в организме мышей с привитой опухолью. Ранее в различных работах было показано, что МСК обладают способностью проникать через гематоэнцефалический барьер и мигрировать от места введения к различным областям мозга [24] .

В результате проведенных нами экспериментов выявлено наличие МСК в опухолевой ткани через 3 и 7 суток после трансплантации. При этом максимальное количество введенных клеток в ткани опухоли отмечено через 3 суток после введения, то есть на ранней стадии канцерогенеза. С помощью флуоресцентной микроскопии был установлен энграфтинг МСК, окрашенных красителем Хехст 33342, в строму опухоли и в эндотелий опухолевых кровеносных сосудов .

По данным лаборатории H. Wang в организме мышей – носителей опухоли люминесцентный сигнал зафиксирован в опухолевой ткани и головном мозге в течении всего период исследования (2 недели), причем интенсивность сигнала постепенно возрастала и достигла максимума к 14 суткам после трансплантации МСК [73]. Различия полученных нами результатов и данных коллектива H. Wang, возможно, связаны с условиями эксперимента: мы вводили МСК через 3 дня после прививки опухоли, а наши коллеги трансплантировали МСК через 7 дней после введения опухолевых клеток .

Через 7 суток после трансплантации в организме интактных животных выявлены лишь единичные МСК в печени, селезенке и головном и костном мозге. Тогда как в организме животных – носителей опухоли зафиксировано значительное количество МСК в костном мозге, небольшое число МСК – в опухолевой ткани и единичные клетки – в печени, селезенке, легких, головном мозге, лимфатических узлах и сердце .

Через 7 и 14 суток после трансплантации максимальное количество МСК в организме мышей – носителей опухоли было обнаружено в костном мозге. Причем число МСК в костном мозге мышей – носителей меланомы В16-F10 было достоверно выше, чем количество МСК в костном мозге здоровых животных .

Мы предпложили, что такое большое число МСК, обнаруженных в костном мозге мышей с привитой опухолью, свидетельствует о метастазировании меланомы В16-F10 в костный мозг .

Существует гипотеза о закономерностях метастатического распространения, согласно которой процесс метастазирования не хаотичен, как представлялось раньше, а подчиняется строго регулируемым биологическим механизмам. Эту гипотезу сформулировал S. Paget в 1889 г. и назвал ее «seed and soil» – гипотеза «зерна и почва», ведущую роль в процессе метастазирования играют не только злокачественные клетки («зерна»), но и их тканевое микроокружение («почва»). То есть метастазирование произойдет тогда и там, где для раковых клеток будут созданы благоприятные условия для развития и роста («преметастатические ниши») [137] .

Костный мозг представляет собой идеальную «почву» для опухолевых клеток, поскольку является достаточно кровоснабженным органом, а клетки костного мозга выделяют огромное количество биологических молекул, которые могут стимулировать пролиферацию раковых клеток [138]. Опухолевые клетки, обнаруженные в костном мозге, называют диссеминированными опухолевыми клетками. Предполагается, что диссеминированные опухолевые клетки (ДОК) свидетельствуют о метастатическом потенциале первичной опухоли [139; 140]. Наличие у пациента ДОК в целом ассоциируется с плохим прогнозом .

Метастатические клетки могут оставаться дремлющими неопределенное время и приобретать способность к пролиферации после различного по продолжительности периода покоя благодаря факторам, природа которых пока полностью не раскрыта. ДОК резистентны в силу того, что нередко они не являются активно пролиферирующими или же защищены благодаря взаимодействию с факторами микроокружения в очаге метастазирования Выявление скрытых диссеминированных [141] .

опухолевых клеток – один из важнейших подходов для раннего выявления метастазов и улучшения результатов лечения .

Экспериментальные данные, полученные нами, обеспечивают прямые доказательства тропизма и энграфтинга МСК в очаг метастазирования в костном мозге. Обнаруженная нами способность МСК мигрировать в сайты метастазирования в костном мозге может быть использована как для диагностики ДОК, так и для адресной доставки противоопухолевых препаратов с помощью МСК в места локализации метастатических клеток .

Через 14 суток после трансплантации в опухолевой ткани обнаруживались некротические изменения и активно продолжались процессы метастазирования. При визуальном осмотре извлеченных органов были обнаружены очаги метастазирования в легких .

На данном сроке значительное число МСК обнаружено в костном мозге, околоопухолевых лимфатических узлах и головном мозге реципиентов – носителей меланомы В16. Также как и через 7 суток после введения на данном сроке максимальное количество МСК детектировано в костном мозге .

Поскольку для меланомы характерен лимфогенный путь метастазирования, логично предположить, что большое число детектированных в регионарных околоопухолевых лимфатических узлах МСК свидетельствует о миграции стволовых клеток в область метастазирования .

В организме здоровых животных небольшое количество стволовых клеток обнаружено в костном мозге, крови, селезенке и головном мозге .

При этом число трансплантированных МСК в костном мозге и головном мозге реципиентов – опухоленосителей достоверно выше по сравнению с количеством МСК в этих органах здоровых реципиентов .

Подводя итог, можно сделать вывод о том, что внутривенное введение МСК костного мозга мышам – носителям меланомы В16 на данной экспериментальной модели не повлияло на опухолевый рост и выживаемость животных – опухоленосителей. Сравнительный анализ распределения стволовых клеток в организме здоровых животных и животных с привитой опухолью показал, что опухолевый процесс влияет на распределение трансплантированных клеток в организме реципиента .

Изучение локализации МСК, окрашенных красителем Хехст 33342, в органах животных – опухоленосителей показало присутствие введенных клеток на различных стадиях канцерогенеза в опухолевой ткани, что подтверждает способность стволовых клеток мигрировать в область развития опухолевого очага. Кроме того, через 7 и 14 суток после трансплантации клеток обнаружен тропизм и энграфтинг МСК в очаг метастазирования в костном мозге. Данный факт может быть использован для разработки нового подхода для диагностики ДОК и адресной доставки противоопухолевых препаратов в очаги метастазирования при помощи МСК .

ЗАКЛЮЧЕНИЕ

В последние годы быстрыми темпами развиваются клеточные технологии, которые привлекают всеобщее внимание не только научными достижениями, но и социальной значимостью. Одной из основных областей применения клеточных технологий в медицине является использование мезенхимальных стволовых клеток в качестве носителей лекарственных препаратов для селективного накопления действующих веществ в опухолевых очагах .

Применение МСК для адресной доставки противоопухолевых препаратов основано на предположении о том, что в условиях канцерогенеза стволовые клетки мигрируют исключительно в опухолевую ткань. Тропизм МСК в область новообразования показан на множестве экспериментальных моделей [4, 5, 6]. Однако в последние годы появляются сообщения о том, что МСК после трансплантации обнаруживаются не только в опухолевом очаге, но и в других органах и тканях [10, 11, 12]. Учитывая расхождение экспериментальных данных, данная работа посвящена исследованию особенностей распределения МСК после трансплантации в условиях опухолевого роста на модели меланомы В16-F10 .

Для исследования возможности применения МСК в качестве средства доставки противоопухолевых препаратов был получен и охарактеризован штамм клеток из костного мозга мышей линии C57BL/6, который обладал признаками, характерными для мезенхимальных стволовых клеток, включая фибробластоподобную морфологию, иммунофенотип, способность адгезироваться к пластику при стандартных условиях культивирования, а также способность дифференцироваться в адипогенном и остеогенном направлении .

Проведенный анализ взаимодействия МСК и клеток меланомы В16F10 в системе in vitro показал усиление миграционной активности МСК при совместном культивировании с клетками меланомы В16. Кроме того установлено, что совместное культивирование клеток меланомы В16-F10 и МСК не оказало влияние на жизнеспособность опухолевых клеток .

Затем исследовали влияние внутривенной трансплантации МСК на продолжительность жизни животных с привитой меланомой В16-F10 и кинетику опухолевого роста. В результате было установлено, что внутривенное введение сингенных МСК на 3 сутки после прививки опухоли мышам не повлияло на рост меланомы В16-F10 и на выживаемость животных – носителей опухоли. Полученные экспериментальные данные могут быть полезными для определения сроков введения МСК при разработке безопасных протоколов противоопухолевой терапии .

Изучение количественного распределения МСК после внутривенного введения в организме интактных мышей и при наличии опухолевого процесса было проведено в следующие сроки: через 1 час после трансплантации МСК, 3, 7 и 14 суток после введения МСК методом ПЦР в реальном времени. Для дополнительного подтверждения результатов ПЦР была выполнена флуоресцентная микроскопия срезов органов мышей с привитой меланомой В16-F10, которым вводили флуоресцентно меченные МСК .

Нами установлено, что максимальное количество МСК через 1 час после внутривенной трансплантации в организме интактных животных и животных – носителей меланомы В16-F10 накапливается в легких .

Через 3 суток после внутривенного введения также выявлены отличия в распределении МСК в норме и в условиях опухолевого роста. В головном мозге и сердце мышей с привитой меланомой обнаружено достоверно более высокое число трансплантированных МСК по сравнению с интактными животными .

Через 7 и 14 суток после введения МСК отличия в распределении клеток после трансплантации усилились. В организме интактных животных на данных сроках выявлены лишь единичные МСК в различных органах. Тогда как максимальное количество МСК в организме мышей – носителей опухоли было обнаружено в костном мозге. Причем число МСК в костном мозге мышей – носителей меланомы В16-F10 было достоверно выше, чем количество МСК в костном мозге здоровых животных .

Таким образом, сравнительный анализ распределения стволовых клеток в организме здоровых животных и животных с привитой опухолью показал, что опухолевый процесс влияет на распределение трансплантированных МСК в организме реципиента на всех исследуемых сроках .

ВЫВОДЫ

1. Получен, охарактеризован и заложен на хранение в коллекцию культур клеток ФБУН ГНЦ ВБ «Вектор» штамм клеток из костного мозга мышей линии C57BL/6, который обладал признаками, характерными для МСК, включая фибробластоподобную морфологию, иммунофенотип, способность адгезироваться к пластику при стандартных условиях культивирования, а также способность дифференцироваться в адипогенном и остеогенном направлении .

2. Установлено, что опухолевые клетки меланомы В16-F10 стимулируют миграционную активность МСК костного мозга в системе in В свою очередь, показано, что в условиях совместного vitro .

культивирования МСК костного мозга мышей не влияют на пролиферацию опухолевых клеток .

3. Доказано, что внутривенное введение сингенных МСК через 3 суток после прививки меланомы В16-F10 не оказывает влияния на опухолевый рост и на выживаемость животных – носителей опухоли .

4. Установлены следующие особенности распределения штамма мезенхимальных стволовых клеток в условиях опухолевого роста после сингенной трансплантации мышам линии C57BL/6:

- В опухолевой ткани максимальное количество введенных МСК выявлено через 3 суток после трансплантации по сравнению с остальными исследованными сроками .

- При внутривенном введении МСК мышам с привитой меланомой В16-F10 распределение этих клеток по органам и тканям в первый час после трансплантации не отличается от распределения у здоровых животных. При этом 50-65 % трансплантированных МСК задерживается в легких, к 3 суткам их количество в легких снижается до 0,5 % .

- Через 3 суток после внутривенного введения МСК мышам с привитой меланомой В16-F10 количество введенных клеток в сердце и головном мозге в несколько раз превышает их количество у здоровых животных, к 7 суткам данная разница исчезает .

- Через 7 и 14 суток после трансплантации более 2000 Y – позитивных клеток/105 клеток органа реципиента обнаружены в костном мозге мышей – носителей меланомы В16-F10, тогда как в костном мозге интактных животных детектированы единичные клетки .

Список сокращений МСК – мезенхимальные стволовые клетки ММСК – мультипотентные мезенхимальные стромальные клетки CD – номенклатура дифференцировочных антигенов клеток CXCR4 – рецептор C-x-C хемокина типа 4 .

SDF-1 – фактор стромальных клеток – 1 c-Met – рецептор тирозин киназы HGF – фактор роста гепатоцитов VEGFR – рецептор фактора роста эндотелия сосудов VEGF – фактор роста эндотелия сосудов CCR2 – C-C хемокиновый рецептор типа 2 MCP-1 – моноцитарный хемоаттрактантный белок uPAR – рецептор активатора урокиназы плазминогена uPA – активатор урокиназы плазминогена IL – интерлейкины IFN- – интерферон бета IFN- – интерферон альфа TRAIL – цитокин семейства факторов некроза опухоли, лиганд, вызывающий апоптоз ФНО – фактор некроза опухоли МРТ – магнитно – резонансная томография КТ – компьютерная томография ОФЭКТ – однофотонная эмиссионная компьютерная томография ПЭТ – позитронно-эмиссионная томография ПЦР – полимеразная цепная реакция GFP – зеленый флуоресцентный белок TGF – трансформирующий фактор роста бета FGF – фактор роста фибробластов IGF – инсулиноподобный фактор PDGF – тромбоцитарный фактор DKK-1 – dickkopf 1 CXCL7 – C-х-C лиганд 7 TLR – Toll-подобные рецепторы CCL5 – C-C лиганд 5 CCLR-5 – рецептор C-C лиганда 5 BMP4 – bone morphogenetic protein 4 PGE2 – простагландин 2

СПИСОК ИСПОЛЬЗУЕМОЙ ЛИТЕРАТУРЫ

1. Miletic, H. Bystander killing of malignant glioma by bone marrowderived tumor-infiltrating progenitor cells expressing a suicide gene / H. Miletic, Y. Fischer, S. Litwak [et al.] // Mol. Ther. – 2007. – V. 15. – P. 1373–1381 .

2. Gunnarsson, S. Intratumoral IL-7 delivery by mesenchymal stromal cells potentiates IFN gamma-transduced tumor cell immunotherapy of experimental glioma / S. Gunnarsson, D. Bexell, A. Svensson //J .

Neuroimmunol. – 2010. – V. 218. – P.140–144 .

3. van Eekelen, M. Human stem cells expressing novel TSP-1 variant have anti-angiogenic effect on brain tumors / M. van Eekelen, L.S. Sasportas, R .

Kasmieh [et al.] // Oncogene. – 2010. – V. 29. – P. 3185–3195 .

4. Studeny, M. Bone marrow-derived mesenchymal stem cells as vehicles for interferon-beta delivery into tumors / M. Studeny, F.C. Marini, R.E .

Champlin [et al.] // Cancer Res. – 2002. – V. 62. – P. 3603–3608 .

5. Studeny, M. Mesenchymal stem cells: potential precursors for tumor stroma and targeted-delivery vehicles for anticancer agents / M. Studeny, F.C. Marini, J.L. Dembinski [et al.] // J. Natl. Cancer Inst. – 2004. – V. 96. – P .

1593–1603 .

6. Kucerova, L. Adipose tissue-derived human mesenchymal stem cells mediated prodrug cancer gene therapy / L. Kucerova, V. Altanerova, M .

Matuskova [et al.] // Cancer Res. – 2007. – V. 67(13). – P. 6304 – 6313 .

7. Yong, R.L. Human bone marrow-derived mesenchymal stem cells for intravascular delivery of oncolytic adenovirus Delta24-RGD to human gliomas / R.L. Yong, N. Shinojima, J. Fueyo [et al.] // Cancer Res. – 2009 – V .

69(23) – P. 8932–8940 .

8. Nakamura, K. Antitumor effect of genetically engineered mesenchymal stem cells in a rat glioma model / K. Nakamura, Y. Ito, Y .

Kawano [et al.] // Gene Ther. – 2004. – V. 11. – P. 1155–1164 .

9. Batchelor, T.T. AZD2171, a pan-VEGF receptor tyrosine kinase inhibitor, normalizes tumor vasculature and alleviates edema in glioblastoma patients / T.T. Batchelor, A.G. Sorensen, E. di Tomaso [et al.] // Cancer Cell.– 2007. – V.11 – P. 83–95 .

10. Wolf, D. Re: Mesenchymal stem cells: potential precursors for tumor stroma and targeted-delivery vehicles for anticancer agents / D. Wolf, H .

Rumpold, R. Koeck [et al.] // J. Natl. Cancer Inst. – 2005. – V. 97. – P. 540-541;

author reply P. 541–542 .

Мелешина, А.В. Исследование взаимодействия мезенхимных 11 .

стволовых клеток и опухоли методами флюоресцентного биоимиджинга / А.В. Мелешина, Е.И. Черкасова, Е.А. Сергеева [и др.] // Современные технологии в медицине. – 2012. – Т. 4. – C. 7–16

12. Bexell, D. Bone marrow multipotent mesenchymal stroma cells act as pericyte-like migratory vehicles in experimental gliomas / D. Bexell, S .

Gunnarsson, A. Tormin [et al.] // Mol Ther. – 2009. – V.17. – P. 183–190 .

13. Friedenstein, A.J. The development of fibroblast colonies in monolayer cultures of guinea-pig bone marrow and spleen cells / A.J .

Friedenstein, R.K. Chailakhjan, K.S. Lalykina // Cell Tissue Kinet. – 1970. – V .

3 – P. 393–403 .

14. Caplan, A.I. Osteogenesis imperfecta, rehabilitation medicine, fundamental research and mesenchymal stem cells / A.I. Caplan // Connect .

Tissue Res. – 1995. – V. 31. – P. 9–14 .

15. Horwitz, E.M. Clarification of the nomenclature for MSC: the international Society for Cellular Therapy position statement / E.M. Horwitz, K .

Le Blanc, M. Dominici [et al.] // Cytotherapy. – 2005. – V. 7. – P. 393–395 .

16. Owen M., Friedenstein A.J. Stromal stem cells: marrow-derived osteogenic precursors. Proceedings of a symposium held at the Ciba Foundation .

London. Oct. 13–15, 1987. London: John Wiley & Sons. 1988; 136: 42-60 .

17. Castro-Malaspina, H. Characterization of human bone marrow fibroblast colony-forming cells (CFU-F) and their progeny / H. CastroMalaspina, R.E. Gay, G. Resnick [et al.] // Blood. – 1980. – V. 56. – P. 289-301 .

18. Mets, T. In vitro aging of human bone marrow derived stromal cells / T. Mets, G. Verdonk // Mech. Ageing Dev. – 1981. – V. 16. – P. 81–89 .

19. Piersma, A.H. Characterization of fibroblastic stromal cells from murine bone marrow / A.H. Piersma, K.G. Brockbank, R.E. Ploemacher [et al.] // Exp. Hematol. – 1985. – V. 13. – P. 237–243 .

20. Colter, D. Rapid expansion of recycling stem cells in cultures of plastic-adherent cells from human bone marrow / D. Colter, R. Class, C.M .

DiGirolamo [et al.] // PNAS. – 2000. – V. 97 – P. 3213–3218 .

21. Bianco, P. Alkaline phosphatase positive precursors of adipocytes in the human bone marrow / P. Bianco, M. Costantini, L.C. Dearden [et al.] // Br. J. Haematol. – 1988. – V.68. – P. 401–403 .

22. Weiss, L. Haemopoiesis in mammalian bone marrow / L. Weiss // Ciba. Found. Symp. – 1981. – V. 84. – P. 5–21 .

23. Makino, S. Cardiomyocytes can be generated from marrow stromal cells in vitro / S. Makino, K. Fukuda, S. Miyoshi [et al.] // J. Clin. Invest. – 1999. – V. 103. – P. 697–705 .

24. Kopen, G.C. Marrow stromal cells migrate throughout forebrain and cerebellum, and they differentiate into astrocytes after injection into neonatal mouse brains / G.C. Kopen, D.J. Prockop, D.G. Phinney // Proc. Natl .

Acad. Sci. – 1999. – V. 96. – P. 10711–10716 .

25. Dominici, M. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement / M. Dominici, K. Le Blanc, I. Mueller [et al.] // Cytotherapy .

– 2006. – V. 8. – P. 315–317 .

Сергеев, В.С. Иммунологические свойства мультипотентных 26 .

мезенхимальных стромальных клеток / В.С. Сергеев // Клеточная трансплантология и тканевая инженерия. – 2005. – Т. 1. – С. 39–42 .

27. Ringden, O. Allogeneic hematopoietic stem cell transplantation:

State of the art and new perspectives / O. Ringden, K. Le Blanc //APMIS. – 2005. – V. 113. – P. 813–830 .

28. Wolff, D. Pharmaceutical and cellular strategies in prophylaxis and treatment of graft-versus- host disease / D. Wolf, B. Steiner, G. Hildebrandt [et al.] // Curr. Pharm. Des. – 2009. – V.15. – P. 1974–1997 .

29. Brooke, G. Therapeutic applications of mesenchymal stromal cells / G. Brooke, M. Cook, C. Blair [et al.] // Semin. Cell. Dev. Biol. – 2007. – V. 18 .

– P. 846–858 .

30. Xu, F. Stem cells tropism for malignant gliomas / F. Xu, J.H. Zhu // Neurosci. Bull. – 2007. – V. 23. – P. 363–369 .

31. Doucette, T. Mesenchymal stem cells display tumor-specific tropism in an RCAS/Ntv-a glioma model / T. Doucette, G. Rao, Y. Yang [et al.] // Neoplasia. – 2011. – V. 13. – P. 716–725 .

32. Horuk, R. Chemokines receptors / R. Horuk // Cytokine Growth Factor Rev. – 2001. – V. 12. – P. 31335 .

33. Wondergem, R. HGF\SF and menthol increase human glioblastoma cell calcium and migration / R. Wondergem, T.W. Ecay, F. Mahieu // Biochem .

Biophys. Res. Commun. – 2008. – V.372. – P. 210–215 .

34. Schmidt, N.O. Brain tumor tropism of transplanted human neural stem cells is induced by vascular endothelial growth factor / N.O. Schmidt, W .

Prylecki, W. Yang [et al.] //Neoplasia. – 2005. – V. 7. – P. 623–629 .

35. Widera, D. MCP-1 induces migration of adult neural stem cells / D .

Widera, W. Holtkamp, F. Entschladen [et al.] // Eur. J. Cell. Biol. – 2004. – V .

83. – P. 381–387 .

36. Gutova, M. Urokinase plasminogen activator and urokinase plasminogen activator receptor mediate human stem cell tropism to malignant solid tumors / M. Gutova, J. Najbauer, R.T. Frank [et al.] // Stem Cells. – 2008 .

– V. 26 – P. 1406–1413 .

37. Wynn, R.F. A small proportion of mesenchymal stem cells strongly express functionally active CXCR4 receptor capable of prompting migration to bone marrow / R.F. Wynn, C.A. Hart, C. Corradi-Perini [et al.] // Blood. – 2004 .

– V. 104. – P. 2643–2645 .

38. Eterno, V. Adipose-derived Mesenchymal Stem Cells (ASCs) may favour breast cancer recurrence via HGF/c-Met signaling / V. Eterno, A .

Zambelli, L. Pavesi [et al.] // Oncotarget. – 2014. – V. 5. – P. 613–633 .

39. Vogel, S. Migration of mesenchymal stem cells towards glioblastoma cells depends on hepatocyte growth factor and is enhanced by aminolaevulinic acid-mediated photodynamic treatment / S. Vogel, C. Peters, N .

Etminan [et al.] // Biochem. Biophys. Res. Commun. – 2013. – V. 431. – P .

428–432 .

40. Hamerlik, P. Autocrine VEGF\VEGFR2 Neuropilin-1 signaling promotes glioma stem-like cells viability and tumor growth / P. Hamerlik, J.D .

Lathia, R. Rasmussen [et al.] // J. Exp. Med. – 2012. – V. 209. – P. 507–20 .

41. Grudzinska, M.K. Monocyte chemoattractant protein 1-mediated migration of mesenchymal stem cells is a source of intimal hyperplasia / M.K .

Grudzinska, E. Kurzejamska, K. Bojakowski [et al.] // Arterioscler. Thromb .

Vasc. Biol. – 2013. – V.33 – P. 1271–1279 .

42. Jarnagin, K. Identification of surface residues of the monocyte chemotactic protein 1 that affect signaling through the receptor CCR2 / K .

Jarnagin, D. Grunberger, M. Mulkins [et al.] // Biochemistry – 1999. – V. 38. – P. 16167-77 .

43. Pulukuri, S.M. Epigenetic upregulation of urokinase plasminogen activator promotes the tropism of mesenchymal stem cells for tumor cells / S.M .

Pulukuri, B. Gorantla, V.R. Dasari [et al.] // Mol. Cancer Res. – 2010. – V. 8. – P. 1074–1083 .

44. Chen X, Lin X, Zhao J. A tumor-selective biotherapy with prolonged impact on established metastases based on cytokine gene-engineered MSCs / X. Chen, X. Lin, J. Zhao [et al.] // Mol Ther. – 2008. – V. 16(4). – P .

749–756 .

45. Xu, X. Evaluating dual activity LPA receptor panantagonist/autotoxin inhibitors as anticancer agents in vivo using engineered human tumors / X. Xu, G. Yang, H. Zhang [et al.] // Prostaglandins Other Lipid Mediat. – 2009. – V. 89. – P. 140–146 .

46. Johns, T.G. Antiproliferative potencies of interferons on melanoma cell lines and xenografts: higher efficacy of interferon beta / T.G. Johns, I.R .

Mackay, K.A. Callister [et al.] // J. Natl. Cancer Inst. – 1992. – V. 84. – P .

1185–1190 .

47. Wong V.L. Growth-inhibitory activity of interferon-beta against human colorectal carcinoma cell lines / V.L. Wong, D.J. Rieman, L. Aronson [et al.] // Int. J. Cancer. – 1989. – V. 43. – P. 526–530 .

48. Nakamizo, A. Human bone marrow-derived mesenchymal stem cells in the treatment of gliomas / A. Nakamizo, F. Marini, T. Amano [et al.] // Cancer Res. – 2005. – V. 65. – P. 3307–3318 .

49. Ren, C. Cancer gene therapy using mesenchymal stem cells expressing interferon-beta in a mouse prostate cancer lung metastasis model / C .

Ren, S. Kumar, D. Chanda [et al.] // Gene Ther. – 2008. – V. 15. – P. 1446– 1453 .

50. Lens, M. Cutaneous melanoma: interferon alpha adjuvant therapy for patients at high risk for recurrent disease / M. Lens // Dermatol. Ther. – 2006. – V.19. – P. 9–18 .

51. Ren, C. Therapeutic potential of mesenchymal stem cells producing interferon-alpha in a mouse melanoma lung metastasis model / C. Ren, S .

Kumar, D. Chanda [et al.] // Stem Cells. – 2008. – V. 26. – P. 2332–2338 .

52. Aboody, K.S. Neural stem cells display extensive tropism for pathology in adult brain: evidence from intracranial gliomas / K.S. Aboody, А .

Brown, N.G. Rainov [et al.] // Proc. Natl. Acad. Sci. USA. – 2000. – V. 97. – P .

12846–12851 .

53. Aghi, M. Oncolytic viral therapies - the clinical experience / M .

Aghi, R.L. Martuza // Oncogene. – 2005. – V. 24. – P. 7802–7816 .

54. Parato, K.A. Recent progress in the battle between oncolytic viruses and tumours / K.A. Parato, D. Senger, P.A. Forsyth [et al.] // Nat. Rev. Cancer. – 2005. – V. 5. 965–976 .

55. Nakashima, H. Directing systemic oncolytic viral delivery to tumors via carrier cells / H. Nakashima, B. Kaur, E.A. Chiocca // Cytokine Growth Factor Rev. – 2010. – V. 21. – P. 119–126 .

56. Power, A.T. Cell-based delivery of oncolytic viruses: a new strategic alliance for a biological strike against cancer / A.T. Power, J.C. Bell // Mol. Ther. – 2007. – V. 15. – P. 660–665 .

57. Pereboeva, L. Approaches to utilize mesenchymal progenitor cells as cellular vehicles / L. Pereboeva, S. Komarova, G. Mikheeva [et al.] // Stem Cells. 2003. – V. 21. – V. 21 – P. 389–404 .

58. Komarova, S. Mesenchymal progenitor cells as cellular vehicles for delivery of oncolytic adenoviruses / S. Komarova, Y. Kawakami, M.A. StoffKhalili // Mol. Cancer Ther. – 2006. – V. 5. – P. 755–766 .

59. Jain, R.K. Angiogenesis in brain tumors / R.K. Jain, E. di Tomaso, D.G. Duda [et al.] // Nat. Rev. Neurosci. – 2007. – V. 8 – P. 610–622 .

60. Samant, R.S. Recent advances in anti-angiogenic therapy of cancer / R.S. Samant, L.A. Shevde //Oncotarget. – 2011 – V. 2. – P. 122–134 .

61. Bexell, D. Bone marrow multipotent mesenchymal stroma cells act as pericyte-like migratory vehicles in experimental gliomas / D. Bexell, S .

Gunnarsson, A. Tormin [et al.] // Mol Ther. – 2009. – V.17. – P. 183–190 .

62. Corsten, M.F. Therapeutic stem-cells for cancer treatment: hopes and hurdles in tactical warfare / M.F. Corsten, K. Shah // Lancet. Oncol. – 2008 .

– V. 9. – P. 376–384 .

63. Walczak, H. The CD95 (APO-1/Fas) and the TRAIL (APO-2L) apoptosis systems / H. Walczak, P.H. Krammer // Exp. Cell. Res. – 2000. – V .

256. – P. 58–66 .

64. Mueller, L.P. TRAIL-transduced multipotent mesenchymal stromal cells (TRAIL-MSC) overcome TRAIL resistance in selected CRC cell lines in vitro and in vivo / L.P. Mueller, J. Luetzkendorf, M. Widder // Cancer Gene Ther. – 2011. – V. 18. – P. 229–239 .

65. Kim, S.K. PEX-producing human neural stem cells inhibit tumor growth in a mouse glioma model / S.K. Kim, T.G. Cargioli, M. Machluf // Clin .

Cancer Res. – 2005. – V. 11. – P. 5965–5970 .

66. Ehtesham, M. Induction of glioblastoma apoptosis using neural stem cell-mediated delivery of tumor necrosis factor-related apoptosis-inducing ligand / M. Ehtesham, P. Kabos, M.A. Gutierrez [et al.] // Cancer Res. – 2002. – V. 62. – P. 7170–7174 .

67. Loebinger, M.R. Mesenchymal stem cell delivery of TRAIL can eliminate metastatic cancer / M.R. Loebinger, A. Eddaoudi, D. Davies [et al.] // Cancer Res. – 2009. – V. 69. – P. 4134–4142 .

68. Maestroni, G.J. Factors from nonmacrophage bone marrow stromal cells inhibit Lewis lung carcinoma and B16 melanoma growth in mice / G.J .

Maestroni, E. Hertens, P. Galli // Cell. Mol. Life Sci. – 1999. – V. 55. – P. 663– 667 .

69. Qiao, C. Human mesenchymal stem cells isolated from the umbilical cord / C. Qiao, W. Xu, W. Zhu [et al.] // Cell Biol. Int. – 2008. – V .

32. – P. 8–15 .

70. Qiao, L. Suppression of tumorigenesis by human mesenchymal stem cells in a hepatoma model / L. Qiao, Z. Xu, T. Zhao [et al.] // Cell Res. – 2008. – V.18. – P. 500–507 .

71. Khakoo, A.Y. Human mesenchymal stem cells exert potent antitumorigenic effects in a model of Kaposi’s sarcoma / A.Y. Khakoo, S. Pati, S.A. Anderson [et al.] // J. Exp. Med. – 2006. – V. 203. P. 1235–1247 .

72. Otsu, K. Concentration-dependent inhibition of angiogenesis by mesenchymal stem cells / K. Otsu, S. Das, S. D. Houser [et al.] // Blood. – 2009 .

– V. 113. – P. 4197–4205 .

73. Wang, H. Trafficking mesenchymal stem cell engraftment and differentiation in tumor-bearing mice by bioluminescence imaging / H. Wang, F .

Cao, A. De [et al.] // Stem Cells. – 2009. – V. 27. – P. 1548–1558 .

74. Xin, H. Intratracheal delivery of CX3CL1-expressing mesenchymal stem cells to multiple lung tumors / H. Xin, R. Sun, M. Kanehira [et al.] // Mol Med. – 2009. – V. 15. – P. 321–327 .

75. Wang, N. Autologous bone marrow stromal cells genetically engineered to secrete an IGF-I receptor decoy prevent the growth of liver metastases / N. Wang, L. Fallavollita, L. Nguyen [et al.] // Mol. Ther. – 2009. – V. 17. – P. 1241–1249 .

76. Sensebe, L. Biodistribution of mesenchymal stem/stromal cells in a preclinical setting / L. Sensebe, S. Fleury-Cappellesso // Stem cells international .

– 2013. – V. 2013. – P. 1–5 .

77. Lee, R. H. Intravenous hMSCs improve myocardial infarction in mice because cells embolized in lung are activated to secrete the antiinlammatory protein TSG-6 / R. H. Lee, A. A. Pulin, M. J. Seo [et al.] // Cell Stem Cell. – 2009. – V.5. – P. 54–63 .

Allers, С. Dynamic of distribution of human bone marrow-derived 78 .

mesenchymal stem cells after transplantation into adult unconditioned mice / С .

Allers, W.D. Sierralta, S. Neubauer [et al.] // Transplantation. – 2004. – V.78. – P. 503–508 .

79. Budde, M.D. Magnetic tagging of therapeutic cells for MRI / M.D .

Budde, J.A. Frank // J. Nucl. Med. – 2009. – V. 50. – P. 171–174 .

80. Anderson, S.A. Noninvasive MR imaging of magnetically labeled stem cells to directly identify neovasculature in a glioma model / S.A. Anderson, J. Glod, A.S. Arbab [et al.] // Blood. – 2005. – V.105. – P. 420–425 .

81. Yaghoubi, S.S. Noninvasive detection of therapeutic cytolytic T cells with 18 F-FHBG PET in a patient with glioma / S.S. Yaghoubi, M.C .

Jensen, N. Satyamurthy [et al.] // Nat. Clin. Pract. Oncol. – 2009. – V. 6. – P .

53–58 .

82. Yaghoubi, S.S. PET imaging of herpes simplex virus type 1 thymidine kinase (HSV1-tk) or mutant HSV1-sr39tk reporter gene expression in mice and humans using [18F]-FHBG / S.S. Yaghoubi, S.S. Gambhir //Nat .

Protoc. – 2006. – V. 1. – P. 3069–3075 .

Rad, A.M. AC133 progenitor cells as gene delivery vehicle and 83 .

cellular probe in subcutaneous tumor models: a preliminary study / A.M. Rad, A.S. Iskander, B. Janic [et al.] // BMC Biotechnol. – 2009. – V. 9. – P. 1–10 .

84. Korf, J. Divalent cobalt as a label to study lymphocyte distribution using PET and SPECT / J. Korf, L. Veenma-van der Duin, R. BrinkmanMedema [et al.] // J. Nucl. Med. – 1998. – V. 39. – P. 836–841 .

85. Gildehaus, F.J. Impact of indium-111 oxine labelling on viability of human mesenchymal stem cells in vitro, and 3D cell-tracking using SPECT/CT in vivo / F.J. Gildehaus, F. Haasters, I. Drosse [et al.] // Mol. Imaging Biol. – 2011. – V.13. – P.1204–1214 .

86. Bindslev, L. Labeling of human mesenchymal stem cells with indium-111 for SPECT imaging: effect on cell proliferation and differentiation / L. Bindslev, M. Haack-Sorensen, K. Bisgaard [et al.] // Eur. J. Nucl. Med. Mol .

Imaging. – 2006. – V. 33. – P. 1171–1177 .

87. Chin, B.B. 111In oxine labelled mesenchymal stem cell SPECT after intravenous administration in myocardial infarction / B.B. Chin, Y .

Nakamoto, J.W.M. Bulte [et al.] // Nucl. Med. Commun. – 2003. – V. 24. – P .

1149–1154 .

88. Singhal, S. Nanotechnology applications in surgical oncology / S .

Singhal, S. Nie, M.D. Wang // Annu. Rev. Med. – 2010. – V. 61. – P. 359–373 .

89. Karnoub, A.E. Mesenchymal stem cells within tumor stroma promote breast cancer metastasis / Karnoub A.E., Dash AB, Vo AP et al. // Nature. – 2007. – V. 449 – P. 557–563 .

90. Klopp, A.H. Tumor irradiation increases the recruitment of circulating mesenchymal stem cells into the tumor microenvironment / A.H .

Klopp, E.L. Spaeth, J.L. Dembinski [et al.] // Cancer Res. – 2007. – V. 67. – P .

11687–11695 .

91. Studeny, M. Bone marrow-derived mesenchymal stem cells as vehicles for interferon-beta delivery into tumors / M. Studeny, F.C. Marini, R.E .

Champlin [et al.] // Cancer Res. – 2002. – V. 62. – P. 3603–3608 .

92. Hung S-C., Deng W-P, Yang WK et al. Mesenchymal stem cell targeting of microscopic tumors and tumor stroma development monitored by noninvasive in vivo positron emission tomography imaging / Hung S-C., Deng W-P, Yang WK [et al.] // Clin. Cancer Res. – 2005. – V.11. – P. 7749–7756 .

93. Reagan, M.R. Concise review: mesenchymal stem cell tumorhoming: detection methods in disease model systems / M.R. Reagan, D.L .

Kaplan // Stem Cells. – 2011. – V. 29. – P. 920–927 .

94. Ortiz, L.A. Mesenchymal stem cell engraftment in lung is enhanced in response to bleomycin exposure and ameliorates its fibrotic effects / L.A .

Ortiz, F. Gambelli, C. McBride [et al.] // Proc. Natl. Acad. Sci. U S A. – 2003. – V. 100. – P. 8407–8411 .

95. Devine, S.M. Mesenchymal stem cells distribute to a wide range of tissues following systemic infusion into nonhuman primates / S.M. Devine, C .

Cobbs, M. Jennings [et al.] // Blood. – 2003. – V. 101. – P. 2999–3001 .

96. Zhu, W. Mesenchymal stem cells derived from bone marrow favor tumor cell growth in vivo / W. Zhu, W. Xu, R. Jiang [et al.] // Exp. Mol. Pathol .

– 2006. – V. 80. – P. 267–274 .

97. Shinagawa, K. Mesenchymal stem cells enhance growth and metastasis of colon cancer / K. Shinagawa, Y. Kitadai, M.Tanaka [et al.] // Int. J .

Cancer – 2010. – V. 127. – P. 2323–2333 .

98. Lu, Y.R. The growth inhibitory effect of mesenchymal stem cells on tumor cells in vitro and in vivo / Y.R. Lu, Y. Yuan, X.J. Wang [et al.] // Cancer Biol. Ther. – 2008. – V. 7. – P. 245–251 .

99. Secchiero, P. Human bone marrow mesenchymal stem cells display anti-cancer activity in SCID mice bearing disseminated non-Hodgkin’s lymphoma xenografts / P. Secchiero, S. Zorzet, C. Tripodo [et al.] // PLoS One .

– 2010. – V. 5. – e11140 .

100. Klopp, A.H. Concise review: dissecting a discrepancy in the literature: do mesenchymal stem cells support or suppress tumor growth? / A.H .

Klopp, A. Gupta, E. Spaeth [et al.] // Stem Cells. – 2011. – V. 29. – P. 11–19 .

101. Quante M. Bone marrow-derived myofibroblasts contribute to the mesenchymal stem cell niche and promote tumor growth / M. Quante, S.P. Tu, H. Tomita [et al.] // Cancer cell. – 2011. – V. 19. – P. 257–272 .

102. Zhang, Y. Stromal progenitor cells from endogenous adipose tissue contribute to pericytes and adipocytes that populate the tumor microenvironment / Y. Zhang, A.C. Daquinag, F. Amaya-Manzanares [et al.] // Cancer research. – 2012. – V. 72. – P. 5198–5208 .

103. Beckermann, B.M. VEGF expression by mesenchymal stem cells contributes to angiogenesis in pancreatic carcinoma / B.M. Beckermann, G .

Kallifatidis, A. Groth [et al.] // British journal of cancer. – 2008. – V.99. – P .

622–631 .

104. Mercier, F.E. The bone marrow at the crossroads of blood and immunity / F.E. Mercier, C. Ragu, D.T. Scadden // Nat. Rev. Immunol. – 2012 .

– V. 12. – P. 49–60 .

105. Liu, S. Breast cancer stem cells are regulated by mesenchymal stem cells through cytokine networks / S. Liu, C. Ginestier, S.J. Ou, [et al.] // Cancer research. 2011. – V. 71. – P. 614–624 .

106. Li, H.-J. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling / H.-J. Li, F .

Reinhardt, H.R. Herschman [et al.] // Cancer discovery. 2012. – V.2. – P. 840– 855 .

107. Roodhart, J.M.L. Mesenchymal stem cells induce resistance to chemotherapy through the release of platinum-induced fatty acids/ J.M.L .

Roodhart, L.G.M. Daenen, E.C.A. Stigter [et al.] // Cancer cell. – 2011. – V. 20 .

– P. 370–383 .

108. Sun, B. Therapeutic potential of mesenchymal stromal cells in a mouse breast cancer metastasis model / B. Sun, K.H. Roh, J.R. Park [et al.] // Cytotherapy. – 2009. – V. 11. – P. 289–298 .

109. Cousin, B. Adult stromal cells derived from human adipose tissue provoke pancreatic cancer cell death both in vitro and in vivo / B. Cousin, E, Ravet, S. Poglio [et al.] //PLoS One. – 2009. – V.4(7). – P. e6278 .

110. Cavarretta, I. T. Adipose tissue-derived mesenchymal stem cells expressing prodrug-converting enzyme inhibit human prostate tumor growth / I.T. Cavarretta, V. Altanerova, M. Matuskova [et al.] // Molecular Therapy. – 2010. – V. 18. P. 223–231 .

111. Potapova, I.A. Mesenchymal stem cells support migration, extracellular matrix invasion, proliferation, and survival of endothelial cells in vitro / I.A. Potapova, G.R. Gaudette, P.R. Brink [et al.] // Stem Cells. – 2007. – V. 25. – P. 1761–1768 .

112. Kinnaird, T. Marrow-derived stromal cells express genes encoding a broad spectrum of arteriogenic cytokines and promote in vitro and in vivo arteriogenesis through paracrine mechanisms / T. Kinnaird, E. Stabile, M.S .

Burnett [et al.] // Circ. Res. – 2004. – V. 94. – P. 678–685 .

113. Al-Khaldi, A. Postnatal bone marrow stromal cells elicit a potent VEGF-dependent neoangiogenic response in vivo / A. Al-Khaldi, N. Eliopoulos, D. Martineau [et al.] // Gene Ther. – 2003. – V. 10. – P. 621–629 .

114. Spaeth, E.L. Mesenchymal stem cell transition to tumor-associated fibroblasts contributes to fibrovascular network expansion and tumor progression / E.L. Spaeth, J.L. Dembinski, A.K. Sasser [et al.] // PLoS One. – 2009. – V. 4. – e4992 .

115. Mishra, P.J. Carcinoma-associated fibroblast-like differentiation of human mesenchymal stem cells / P.J. Mishra, R. Humeniuk, D.J. Medina [et al.] // Cancer Res. – 2008. – V. 68. – P. 4331–4339 .

116. Krampera, M. Bone marrow mesenchymal stem cells inhibit the response of naive and memory antigen-specific T cells to their cognate peptide / M. Krampera, S. Glennie, J. Dyson [et al.] // Blood. – 2003. – V. 101. – P .

3722–3729 .

117. Plumas, J. Mesenchymal stem cells induce apoptosis of activated T cells / J. Plumas, L. Chaperot, M.J. Richard [et al.] // Leukemia. – 2005. – V. 19 .

– P. 1597–1604 .

118. Waterman, R.S. A new mesenchymal stem cell (MSC) paradigm:

polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype / R.S. Waterman, S.L. Tomchuck, S.L. Henkle [et al.] // PLoS One. – 2010. – V. 5. – e10088 .

119. Zeng, Z. Targeting the leukemia microenvironment by CXCR4 inhibition overcomes resistance to kinase inhibitors and chemotherapy in AML / Z. Zeng, Y.X. Shi, I.J. Samudio [et al.] // Blood. – 2008. – V. 113. – P. 6215– 6224 .

120. Klopp, A.H. Mesenchymal stem cells promote mammosphere formation and decrease e-cadherin in normal and malignant breast cells / A.H .

Klopp, L. Lacerda, A. Gupta [et al.] // PLoS One. – 2010. – V. 5. – e12180 .

121. Quante M. Bone marrow-derived myofibroblasts contribute to the mesenchymal stem cell niche and promote tumor growth / M. Quante, S.P. Tu, H. Tomita [et al.] // Cancer cell. – 2011. – V. 19. – P. 257–272 .

122. Li, J. Silencing of signal transducer and activator of transcription 3 expression by RNA interference suppresses growth of human hepatocellular carcinoma in tumor-bearing nude mice / J. Li, Y.F. Piao, Z. Jiang [et al.] // World J. Gastroenterol. – 2009. – V.15 – P. 2602–2608 .

123. Kaplan, E. L. Nonparametric estimation from incomplete observations / E. L. Kaplan, P. Meier // J. Amer. Statist. Assn. – 1958 – V.53. – P. 457–481 .

124. Jlkowska, J. Hematopoietic chimerism after allogeneic stem cell transplantation: a comparison of quantitative analysis by automated DNA sizing and fluorescent in situ hybridization / J. Jlkowska, A. Pieczonka, T. Strabel [et al.] // BMC Blood Disord. – 2005. – V. 10 – P. 1 .

125. Гланц, С. Медико-биологическая статистика / С. Гланц. – Пер .

с англ. – 1999. – М. – 459 с .

126. Momin, E. Mesenchymal stem cells: new approaches for the treatment of neurological diseases / E.N. Momin, A. Mohyeldin, A. Hasan [et al.] // Curr Stem Cell Res Ther. – 2010. – V. 5. – P. 326–344 .

127. da Silva Meirelles, L. Mesenchymal stem cells reside in virtually all post-natal organs and tissues / L. da Silva Meirelles, P.C. Chagastelles, N.B .

Nardi [et al.] // J Cell Sci. – 2006. – V. 119. – P. 2204–2213 .

128. Romanov, Y.A. Searching for alternative sources of postnatal human mesenchymal stem cells: candidate MSC-like cells from umbilical cord / Y.A. Romanov, V.A. Svintsitskaya, V.N. Smirnov [et al.] // Stem Cells. – 2003 .

– V. 21. – P. 105–110 .

129. Dominici, M. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement / M. Dominici, K. Le Blanc, I. Mueller [et al.] // Cytotherapy .

– 2006. – V. 8. – P. 315–317 .

130. Djouad, F. Immunosuppressive effect of mesenchymal stem cells favors tumor growth in allogeneic animals / F. Djouad, P. Plence, C. Bony [et al.] // Blood. – 2003. – V. 102. – P. 3837–3844 .

131. Kholodenko, I.V. Molecular mechanisms of migration and homing of intravenously transplanted mesenchymal stem cells / I.V. Kholodenko, A.A .

Konieva, R.V. Kholodenko [et al.] // J. Regen. Med. Tissue Eng. – 2013. – V. 2 .

– P. 1–11 .

132. Соловьева, А.О. Способы мечения клеток для визуализации in vivo / А.О. Соловьева, К.Э. Зубарева, А.Ф. Повещенко [и др.] // Клеточная трансплантология и тканевая инженерия. – 2013 – Т. 8. – С. 33–38 .

133. Kyriakou, C. Factors that influence short-term homing of human bone marrow derived mesenchymal stem cells in a xenogeneic animal model / Kyriakou C, Rabin N, Pizzey A, [et al.] // Haematologica. – 2008. – V. 93. – P .

1457–1465 .

134. Byun, J.S. Engraftment of human mesenchymal stem cells in a rat photothrombotic cerebral infarction model: comparison of intra-arterial and intravenous infusion using MRI and histological analysis / J.S. Byun, B.K .

Kwak, J.Kim [et al.] //J. Korean Neurosurg. Soc. – 2013. – V. 54. – P. 467–476 .

135. Gao J. The dynamic in vivo distribution of bone marrow-derived mesenchymal stem cells after infusion / J. Gao, J.E. Dennis, R.F. Muzic [et al.] // Cells Tissues Organs. – 2001. – V. 169. – P. 12–20 .

136. Barbash, I.M. Systemic delivery of bone marrow-derived mesenchymal stem cells to the infarcted myocardium: feasibility, cell migration, and body distribution / I.M. Barbash, P. Chouraqui, J. Baron [et al.] // Circulation. – 2003. 2003. – V. 108. – P. 863–868 .

137. Ribatti, D. Stephen Paget and the «seed and soil» theory of metastatic dissemination / D. Ribatti,G. Mangialardi, A. Vacca // Clin Exp Med .

– 2006. – V. 6(4). – P. 145 – 149 .

138. Przybyla, B.D. Molecular changes in bone marrow, tumor and serum after conductive ablation of murine 4T1 breast carcinoma / B.D .

Przybyla, G. Shafirstein, S.J. Vishal [et al.] // Int J Oncol. – 2014. – V. 44. – P .

600–608 .

139. Paterlini-Brechot, P. Circulating tumorous cells in patients with hepatocellular carcinoma / P. Paterlini-Brechot, G. Vona, C. Brechot // Clinical impact and future directions. Semin Cancer Biol. – 2000. – V. 10(3). – P. 241–9 .

140. Mocellin, S. Circulating tumor cells: the 'leukemic phase' of solid cancers. / S. Mocellin, U. Keilholz, C.R. Rossi [et al.] // Trends Mol Med. –

2006. V. 12(3). – P.130 – 139 .

141. Hermanek P. Disseminated tumor cells versus micrometastasis:

definitions and problems / P. Hermanek // Anticancer Res. – 1999. – V.19(4A) .

– P. 2771 – 2774 .






Похожие работы:

«Многопоточные архитектуры 03.12.2014 Программная многопоточность Тема 1/3 Поток исполнения (так же нить, thread) Пример программы: Ход исполнения программы: void func() {. t return; Вызов функции } Возврат из функции int main() • Существует единственный { поток исполнения программы.• Последовательность пот...»

«Министерство образования и науки Российской Федерации САРАТОВСКИЙ НАЦИОНАЛЬНЫЙ ИССЛЕДОВАТЕЛЬСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ ИМЕНИ Н.Г . ЧЕРНЫШЕВСКОГО Кафедра общей геологии и полезных ископаемых "Оценка загрязнения грунтовых вод и почво-грунтов нефтепродуктами в зонах вли...»

«Будущее благодаря многолетнему опыту Rhepanol® fk Rhepanol fk на всех плоских кровлях мира как у себя дома КРАТКО Rhepanol fk – старейшая в мире синтетическая кровельная мембрана 50-летний опыт гидроизоляции на основе PIB свыше 95 млн. кв. метров уложенных кровель по всему миру стандарт по DIN EN 13956 и...»

«Пояснительная записка Рабочая программа по технологии для 7 а класса составлена с учетом стандартов основного общего образования по технологии, на основе примерной программы основного о...»

«Известия Самарского научного центра Российской академии наук. Социальные, гуманитарные, медико-биологические науки, т . 18, №1(2), 2016 Izvestiya of the Samara Science Centre of the Russian Academy of Sciences. Social, humanitarian, medicobiological sciences, Vol.18, no. 1(2), 2...»

«ВВЕДЕНИЕ Раздел "Охрана окружающей среды" проекта "Групповой водовод со станцией водоочистки и зонами санитарной охраны в п.Вурнары Вурнарского района Чувашской Республики (1 пусковой комплекс)" представляет собой реализацию 32 статьи Федерального закона Российской Федерации Об охране окружающей среды от 10.01.20...»

«ФЕДОРОВА ОКСАНА ИВАНОВНА ВЛИЯНИЕ ДОМЕСТИКАЦИИ НА ХОЗЯЙСТВЕННО ПОЛЕЗНЫЕ И МОРФОФИЗИОЛОГИЧЕСКИЕ ПРИЗНАКИ НОРКИ АМЕРИКАНСКОЙ (MUSTELA VISON SCHREBER, 1777), ХОРЬКА (MUSTELA PUTORIUS L., 1758) И СУРКА СТЕПНОГО (MARMOTA BOBAK MULL., 1776) ПРИ ПРОМЫШЛЕННОЙ ТЕХНОЛОГИИ РАЗВЕДЕНИЯ 0...»

«СРГ ПДООС ПОВЕСТКА ДНЯ УЧЕБНОГО СЕМИНАРА "ОЦЕНКА ЭКОЛОГИЧЕСКИХ ПРОЕКТОВ, ФИНАНСИРУЕМЫХ ЗА СЧЕТ ГОСУДАРСТВЕННЫХ СРЕДСТВ" УЧЕБНЫЙ СЕМИНАР ДЛЯ ЭКСПЕРТОВ МОЛДОВЫ 16 – 19 ЯНВАРЯ 2007 Г., КИШИНЕВ Исходная информация Последние несколько лет совершенствование управления государственными природоохранными расходами, в целом, и государственн...»

«Московский государственный университет им. М.В.Ломоносова Биологический факультет Кафедра биохимии Дипломная работа студента 5 курса Матлашова Михаила Егоровича Изучение влияния замен G126A и G126R на физикохимические и функциональные характеристики тропомиозина человека Работа выполнена в лаборатории молекулярной организации биологичес...»

«Правительство Российской Федерации Федеральное государственное автономное образовательное учреждение высшего профессионального образования Национальный исследовательский университет Высшая школа экономики Фак...»

«CAAF/09-WP/22 Международная организация гражданской авиации 9/10/09 РАБОЧИЙ ДОКУМЕНТ КОНФЕРЕНЦИЯ ПО АВИАЦИИ И АЛЬТЕРНАТИВНЫМ ВИДАМ ТОПЛИВА Рио-де-Жанейро, Бразилия, 16–18 ноября 2009 года Пункт 4 повестки дня. Производство и инфраструктура ИСПОЛЬЗОВАНИЕ АНАЛИЗА ЗАТРАТ-ВЫГОД ДЛЯ ИНВ...»

«ЮЖНО-УРАЛЬСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ УТВЕРЖДАЮ: Директор института Высшая школа экономики и управления _И. П. Савельева 24.06.2017 РАБОЧАЯ ПРОГРАММА к ОП ВО от 03.11.2017 №007-03-1363 дисциплины Б.1.14 История таможенного дела и таможенно...»

«МИНИСТЕРСТВО САРАТОВСКОЙ ОБЛАСТИ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ САРАТОВСКОЙ ОБЛАСТИ "ДЕРГАЧЕВСКИЙ АГРОПРОМЫШЛЕННЫЙ ЛИЦЕЙ" _ "Рассмотрено" "Согласовано" "Утверждаю" На заседании МК Зам. Директора по УПР Директор №_...»

«Труды БГУ 2015, том 10, часть 1  Микробиология  УДК 579.841.11+577.175.132 СОЗДАНИЕ НА ОСНОВЕ РИЗОСФЕРНЫХ БАКТЕРИЙ РОДА PSEUDOMONAS ШТАММА-ПРОДУЦЕНТА ГОРМОНА РОСТА РАСТЕНИЙ ГИББЕРЕЛЛИНА И.Н. Феклистова, Д.В. Маслак, И.А. Гринева, Л.Е. Садовская, Т.Л. Скакун, Н.П. Максимова Белорусский гос...»

«МИОЛОГИЯ – УЧЕНИЕ О МЫШЦАХ При изучении миологии необходимо постоянно обращаться к предыдущим разделам анатомии – остеологии и артросиндесмологии. При этом рекомендуется повторять костные образования, связанные с местами начала и прикрепления мышц, и строение суставов.Знать: мет...»

«TAU-2M.IP Руководство по эксплуатации, версия 1.3 (02.2016) Абонентский шлюз IP-телефонии IP-адрес: http://192.168.1.1 имя пользователя: admin пароль: password Версия документа Дата выпуска Содержание изменений Версия 1.3 03.02.2016 Синхронизация с версией ПО 1.13.0.119 Добавлено: 3.6.2.7 Подменю...»

«Издание второе дополненное Е.Н.Аитова, кандидат биологических наук И.А.Рудаков, доктор медицинских наук РУКОВОДСТВОБИБЛИОТЕКА ДИСТРИБЬЮТОРА ПО ПРИМЕНЕНИЮ ПРОДУКЦИИ СПРАВОЧНИК ПО ПРОДУКЦИИ ANTI-AGE. CРЕДСТВА ПРОТИВ СТАРЕНИЯ КОЖИ Старение организма и старение кожи – одна из главных проблем медицины...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ БЕЛОРУССКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ БИОЛОГИЧЕСКИЙ ФАКУЛЬТЕТ Кафедра клеточной биологии и биоинженерии растений БАЛКОВСКАЯ Анна Владимировна СОЗДАНИЕ КОЛЛЕКЦИИ АСЕПТИЧЕСКИХ КУЛЬТУР ТРУДНОРАЗМНОЖАЕМЫХ СОРТОВ КЛЕМАТИСОВ Аннотация к дипломной работе На...»

«Муниципальное казённое общеобразовательное учреждение Тогучинского района "Лебедевская средняя школа" ПРИШКОЛЬНЫЙ УЧЕБНО-ОПЫТНЫЙ УЧАСТОК 2017 г СОДЕРЖАНИЕ 1. Положение об учебно-опытном участке..3 2. Паспорт учебно-опытного участка.9 3. Календарный план работ на учебно-опытном участке на 2017-20...»

«ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ УЧРЕЖДЕНИЕ НАУКИ ИНСТИТУТ ВОДНЫХ И ЭКОЛОГИЧЕСКИХ ПРОБЛЕМ СИБИРСКОГО ОТДЕЛЕНИЯ РОССИЙСКОЙ АКАДЕМИИ НАУК (ИВЭП СО РАН) УТВЕРЖДАЮ: ВрИО директора ИВЭП СО РАН _ д.б.н. А.В. Пузанов "29" апреля 2016 г. ПРОГРАММА ВСТУПИТЕЛЬНОГО ЭКЗАМЕНА в аспирантуру по направлению подготовки 05.06.01 "Науки о Земле" (профи...»

«СО РАН и 70-летию образования Красноярского края, 1-3 сентября 2004 г., г. Красноярск. Красноярск, 2004. С. 131 133. Денисов, Н.И. Деревянистые лианы российского Дальнего Востока. [Текст] / Н.И. Денисов. Владивосток: Дальнаука, 2003. 348 с. Популяционная организация растит...»

«СЕЛЬСКОХОЗЯЙСТВЕННАЯ БИОЛОГИЯ, 2009, 3 Обзоры, проблемы, итоги УДК 633/635:576.31 ЦЕНТРОМЕРНЫЕ БЕЛКИ ХРОМОСОМ У ВЫСШИХ РАСТЕНИЙ . СООБЩЕНИЕ I. СТРУКТУРА И ФУНКЦИИ ЦЕНТРОМЕРНЫХ КОМПЛЕКСОВ (обзор иностранной лите...»

«ПОТЕРИ НАУКИ Самарская Лука: проблемы региональной и глобальной экологии. Самарская Лука. 2009. – Т. 18, № 1. – С. 230-236. УДК 59(092)+597.6+598.1 ВАЛЕРИЙ ИОСИФОВИЧ ВЕДМЕДЕРЯ (1946–2008) © 2009 А.И. Зиненко Музей прир...»

«Группа трансгендерных людей является довольно немногочисленной. Этот факт во многом объясняет отсутствие какой-либо информации об их трудоустройстве и адаптации на рабочих местах. Однако трансгендерные люди испытывают, пожалуй, самые серьезные сложности с трудоустройством по сравнению с другими...»

«СОВРЕМЕННАЯ МОЛОДЕЖЬ: ПРОБЛЕМА САМООРГАНИЗАЦИИ Литвинович В. М. (г. Минск) В современном мире любое общество можно рассматривать как сложноорганизованную саморазвивающуюся открытую си стему, которая обладает многими специфическими чертами: самодостаточностью, интегративностью, непредсказуемостью развития, разнообразием различных социальных стру...»




 
2019 www.mash.dobrota.biz - «Бесплатная электронная библиотека - онлайн публикации»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.